2019 лада: новые модели и успехи Бренда


0
Categories : Разное

Содержание

полный каталог моделей, характеристики, отзывы на все автомобили Lada (Лада)

По-русски

Лада

Категория бренда
Российские автомобили
Год основания:
1971
Основатели:
ЦК КПСС и Советское правительство
Количество моделей:
20
Принадлежит:
ОАО «АвтоВАЗ»
Новостей на сайте:
1061 перейти
Наших тест-драйвов:
52 перейти



Автомобили Lada

  • 2104

    1 поколение, 1984 — сегодня
  • 2107

    1 поколение, 1982 — сегодня
  • 2110 (2111,21112)

    1 поколение, 1996 — 2010
  • 4×4

    1 поколение, 1995 — 2018
  • Granta

    2 поколения, 2011 — сегодня
  • Granta Cross

    1 поколение, 2019 — сегодня
  • Granta Sport

    1 поколение, 2017 — сегодня
  • Kalina

    2 поколения, 2004 — сегодня
  • Kalina Cross

    1 поколение, 2016 — сегодня
  • Kalina NFR

    1 поколение,
    2017 — сегодня
  • Kalina Sport

    1 поколение, 2017 — сегодня
  • Largus

    2 поколения, 2012 — сегодня
  • Largus Cross

    1 поколение, 2014 — 2019
  • Priora

    1 поколение, 2009 — сегодня
  • Samara

    1 поколение, 2001 — сегодня
  • Vesta

    1 поколение, 2015 — сегодня
  • Vesta Cross

    1 поколение, 2018 — сегодня
  • Vesta Sport

    1 поколение, 2019 — сегодня
  • XRay

    1 поколение, 2015 — сегодня
  • Xray Cross

    1 поколение, 2019 — сегодня

О Lada

Компания ОАО «АвтоВАЗ» является крупнейшим производителем автомобилей в России. Бренд Lada принадлежит российскому автогиганту со времен СССР. Основная производственная мощность расположена в Самарской области в городе Тольятти. История компании началась с 1967 года, когда был построен завод совместно с итальянским FIAT. Первый автомобиль сошел с конвейера в 1970 году. Это был седан ВАЗ-2101, сделанный на базе FIAT-124. Через 7 лет появился на свет первый полноприводный внедорожник компании «Нива». Начало массового производства пеерднеприводных машин в России положил выпуск в 1984 году модели ВАЗ-2108 или Lada Samara. На сегодняшний день Lada расширила свой модельный ряд переднеприводных автомобилей семействами Kalina и Priopa. Кроме того, не останавливается производство машин повышенной проходимости совместно с американским концерном Chevrolet. В ближайшие годы «АвтоВАЗ» планирует выпуск еще семи совершенно новых моделей под именами: Quanta, Alegra, Slavia, Adera, Terra и Fortuna.


Все модели Lada

ЮГ-АВТО официальный дилер | Новые и авто с пробегом в Краснодаре, Новороссийске и Республике Адыгея. Адреса автосалонов.

При обслуживании клиентов и выполнении работ мы ориентируемся на стандарты производителей, что гарантирует не только выгодное приобретение, но и сервис мирового уровня, долгий срок службы, нашу помощь во время всего периода эксплуатации.

С Юг-Авто вам не придется тратить время на поиск идеального предложения. Для того чтобы купить современный автомобиль, будь то элегантный седан или внушительный внедорожник, спортивное купе или семейный минивэн, достаточно посетить наши центры, где высококвалифицированные консультанты сориентируют вас по каждой модели.

Автосалоны дилерской сети Юг-Авто расположены в Краснодаре, Новороссийске, Майкопе, п. Яблоновский республики Адыгея. В каждом салоне предоставляется полный комплекс услуг по сопровождению сделки, техническому обслуживанию, предлагаются вспомогательные сервисы:

  • Тест-драйв. Прежде чем выбрать автомобиль, протестируйте его в реальных условиях, оцените оснащение и комфорт.
  • Кредит. Благодаря партнерским связям Юг-Авто с ведущими банками и финансовыми организациями, клиенты получают актуальные предложения и эксклюзивные кредитные пакеты.
  • Trade in. Покупка по программе Trade in позволяет существенно сэкономить время, получить справедливую оценку подержанной машины, выгодно обменять ее на новую или с пробегом.
  • Продажа автомобилей с пробегом. Каждый б/у автомобиль был проверен по чек-листу производителя и прошел многоуровневую предпродажную подготовку.
  • Лизинг. Грамотная оптимизация расходов компании, привлекательная схема выплат, высокая остаточная стоимость, возможность выкупа по завершении договора.
  • Корпоративное обслуживание. Персонифицированное сопровождение автопарка предприятия специалистом отдела по работе с корпоративными клиентами.
  • Помощь на дороге. Наши клиенты не остаются наедине с проблемами. Круглосуточная консультационная и юридическая поддержка, техническая помощь при аварии, эвакуация до ближайшего сервисного центра.
  • Специальные предложения. Регулярные акции, выгодные условия покупки, ремонта и обслуживания автомобиля.

АВТОВАЗу исполняется 55 лет — Экономика. НИА Самара, 20.07.2021

20 июля 2021 года исполняется 55 лет с момента подписания правительственного постановления о строительстве в городе Тольятти автомобильного завода. Этот день считается датой основания АВТОВАЗа. 

За 55 лет АВТОВАЗ произвел более 30 миллионов автомобилей более чем 50 разных моделей. Автомобили LADA составляют треть российского легкового автопарка, и лидируют по продажам на отечественном рынке с долей 23%.

АВТОВАЗ сегодня – предприятие полного цикла, с собственной металлургией, прессовым производством, мощностями по изготовлению автокомпонентов, включая силовые агрегаты и шасси. Научно-технический центр АВТОВАЗа позволяет провести полную разработку автомобиля, от дизайн-проекта до подготовки к серийному производству.

На АВТОВАЗе работает три автосборочных линии, с которых ежедневно сходят около 1500 автомобилей марок LADA и Renault. Все три линии прошли модернизацию и работают в соответствии со стандартами Renault Group. 

АВТОВАЗ: основные даты истории

1966 – принято правительственное постановление о строительстве в Тольятти нового завода по производству легковых автомобилей.

1967 – началось строительство Волжского автозавода.

1968 – зарегистрирован товарный знак в виде ладьи.

1970 – начат выпуск автомобилей (ВАЗ-2101, ставшая самой массовой моделью в истории автостроения России).

1971 – ВАЗ-2101 приняла участие в ралли «Тур Европы». Началась история заводского автоспорта.

1971 – первая партия ВАЗ-2101 отправлена на экспорт.

1973 – выпущен первый миллионный автомобиль (ВАЗ-2103), одновременно автозавод принят в эксплуатацию государственной комиссией.

1976 – начат выпуск ВАЗ-2106, которая стала второй по массовости после ВАЗ-2101 (4,2 млн экземпляров).

1977 – начало производства внедорожника «Нива».

1980 – начат выпуск ВАЗ-2105. 

1984 – освоение переднего привода, начало производства ВАЗ-2108.

1986 – принято решение о создании на АВТОВАЗе отраслевого научно-технического центра.

1989 – стартовало производство микролитражки «Ока».

1990 – начало выпуска ВАЗ-21099, последней модели, освоенной в советский период.

1995 – старт производства LADA 110.

1998 – открыт комплекс большой аэродинамической трубы, не имеющий аналогов в России.

2000 – ВАЗ-2101 назван Российским автомобилем ХХ столетия.

2004 – старт производства LADA Kalina.

2007 – началось серийное производство LADA Priora.

2008 – подписано соглашение о стратегическом партнерстве с компанией Renault.

2011 – стартовало производство LADA Granta.

2012 – LADA впервые получила автоматическую коробку передач.

2012 – старт выпуска первого совместного с Renаult продукта, универсала LADA Largus.

2015 – старт производства LADA Vesta и LADA XRAY.

2017 – впервые налажен серийный выпуск битопливного автомобиля – LADA Vesta CNG.

2017 – стартовали продажи автомобилей LADA Vesta SW и LADA Vesta SW Cross.

2018 – стартовало производство седана LADA Vesta Cross, нового семейства LADA Granta, кроссовера LADA XRAY Cross.

2019 – стартовали продажи LADA Vesta Sport и LADA Granta Cross.

2020 – выпущен 30-миллионный автомобиль LADA. 

2021 – стартовали продажи нового LADA Largus и новой LADA Niva Travel.

Расширенная нормализация FRET позволяет проводить количественный анализ белковых взаимодействий, включая стехиометрию и относительную аффинность в живых клетках.

Используемые плазмиды

Все плазмиды, которые мы использовали, доступны из коллекции лаборатории Шмида. Банк данных, содержащий их, доступен в Интернете по адресу http://www.meduniwien.ac.at/user/johannes.schmid/. Используемые плазмиды и карты перечислены на дополнительном рисунке 11.

Подготовка образцов клеток

Все эксперименты проводились на клетках HeLa, клон ACC 57.Клетки пассировали за день до трансфекции, достигая слияния 70-80% в день трансфекции. Для микроскопических экспериментов клетки высевали на 8-луночные предметные стекла там же. Для проточной цитометрии клетки высевали в 24-луночные многолуночные планшеты. Для достижения охвата в широком диапазоне соотношений акцептора к донору плазмиды, несущие донор или акцептор, трансфицировали в пяти различных массовых соотношениях: 5: 1, 3: 1, 1: 1, 1: 3 и 1: 5. Трансфекция была достигнута с помощью реагента для трансфекции TurboFect ™ (Thermo Scientific ™, каталожный номер: R0531) в соответствии со спецификациями продукта.

Получение и оценка микроскопических изображений

Микроскопия проводилась на конфокальной системе лазерного сканирования Nikon A1 R +, оснащенной 12-битными детекторами, с использованием апохроматического масляного иммерсионного объектива 60x (NA1.4). Донорный канал был получен при возбуждении на 488 нм и эмиссионном фильтре 525/50. Канал FRET был получен при возбуждении на 488 нм и эмиссионном фильтре 595/50. Акцепторный канал был получен при возбуждении на 561 нм и эмиссионном фильтре 595/50.

Измерения фотообесцвечивания акцептора проводились на Nikon A1 с использованием иммерсионного объектива с плоским апохроматическим маслом и иммерсией 60x (NA1.4). Фотодеструкция применялась на длине волны 561 нм при 100% мощности лазера в течение одной секунды (лазер: Melles Griot 85-YCA-020, выходная мощность 20 мВт при 561 нм ± 0,5 нм).

Оценка изображений проводилась с использованием программного пакета Fiji из ImageJ (https://fiji.sc/) и набора самописных макросов FRET, которые находятся в свободном доступе под GPLv3 (General Public License версии 3). ) на GitHub под (https://github.com/BHochreiter). Предоставляется описание и протокол использования этих макросов для оценки (дополнительный рис.7).

Получение и оценка проточной цитометрии

Измерения FRET на основе проточной цитометрии были выполнены на приборе CYTOFLEX S (Beckman Coulter, серийный номер AW19039, используя следующие настройки каналов. Донорный канал: лазерное возбуждение 488 нм, 525/40 Эмиссионный фильтр БП (505–545 нм), канал FRET: лазерное возбуждение 488 нм, эмиссионный фильтр 610/20 БП (600-620 нм), канал акцептора: лазерное возбуждение 561 нм, эмиссионный фильтр 610/20 БП (600-620 нм)

Программа CytExpert (https: // www.beckman.com/coulter-flow-cytometers/software) использовался для сбора данных и стробирования анализируемых популяций. Программное обеспечение FlowPy (http://flowpy.wikidot.com/) использовалось для извлечения данных из файлового формата FCS в текстовый формат с разделителями табуляции.

Оценка отбеливания акцептора

В качестве альтернативного метода для определения эффективности FRET мы использовали метод фотообесцвечивания акцептора, который использует прямое сравнение интенсивности излучения донора до и после фотодеструкции акцепторного флуорофора, после чего большинство измерений и инструментов вызванные искажения не имеют значения, и поэтому результат является прямым коррелятом физического процесса.Однако многие флуорофоры демонстрируют определенные спектральные аномалии при освещении сильным источником света, которые необходимо учитывать перед анализом FRET. Донорские флуорофоры иногда могут быть совместно обесцвечены или, наоборот, фотоактивированы освещением с определенной длиной волны акцептора, что приводит к изменению сигнала флуоресценции без присутствия FRET. Другое явление — фотопереключение акцептора после обесцвечивания, когда акцептор не теряет свою эмиссию, а переходит на другой профиль эмиссии, который часто можно обнаружить в донорном канале 12,13 .

Поправочные коэффициенты df (совместное обесцвечивание и фотоактивация донора) и af (фотопереключение акцептора) используются для учета этих эффектов и определяются для образцов, содержащих только донор или акцептор.

$$ df = \ frac {{D} _ {dpost} — {D} _ {dpre}} {{D} _ {dpre}} $$

(2)

$$ af = \ frac {{D} _ {apost} — {D} _ {apre}} {{A} _ {apre} — {A} _ {apost}} $$

(3)

, где «пост» означает интенсивность после отбеливания с акцепторно-специфическим возбуждением, а «до» — значение до.{c}} $$

(5)

Расчет коэффициентов нормализации C1 и C2

Сигналы донора, FRET и акцептора требуют нормализации, чтобы преобразовать их в одно и то же измерение и сделать возможным расчет относительных концентраций и соотношений доноров и акцепторов. C1 и C2 нормализуют донор или акцептор соответственно к сигналу в канале FRET. Они требуют информации от конструкции с известной эффективностью переноса и стехиометрией. Каждый измеренный эксперимент включал популяцию, трансфицированную тандемной слитой конструкцией mCherry-YFP, которая удовлетворяет этим требованиям.{c} \ ast C2} $$

(8)

Расчет различных измерений FRET по полученным сигналам

Из-за спектральных свойств флуорофоров сигналы донора, акцептора и канала FRET должны корректироваться на спектральные перекрестные помехи (или просачивание) от другого флуорофора. Во-первых, четыре спектральных коэффициента прохождения определяются с использованием образцов, содержащих только донорный или акцепторный флуорофор. В литературе можно найти разные номенклатуры для этих факторов — в данной работе используются S1 – S4 31 .S1 и S3 описывают спектральный поток флуоресценции донора в FRET и акцепторный канал соответственно, тогда как S2 и S4 описывают спектральный поток флуоресценции акцептора в FRET и донорный канал соответственно. (Список математических параметров в уравнениях приведен в таблице 1)

$$ {\ rm {donor}} \, {\ rm {into}} \, {\ rm {FRET}} \, {\ rm { channel}}: {S} _ {1} = \ frac {{F} _ {d}} {{D} _ {d}} $$

(9)

$$ {\ rm {acceptor}} \, {\ rm {into}} \, {\ rm {FRET}} \, {\ rm {channel}}: {S} _ {2} = \ frac { {F} _ {a}} {{A} _ {a}} $$

(10)

$$ {\ rm {donor}} \, {\ rm {into}} \, {\ rm {acceptor}} \, {\ rm {channel}}: {S} _ {3} = \ frac { {A} _ {d}} {{D} _ {d}} $$

(11)

$$ {\ rm {acceptor}} \, {\ rm {into}} \, {\ rm {donor}} \, {\ rm {channel}}: {S} _ {4} = \ frac { {D} _ {a}} {{A} _ {a}} $$

(12)

Таблица 1 Список переменных.{c} = \ frac {{A} _ {da} — {S} _ {3} \ ast {D} _ {da}} {1- {S} _ {3} \ ast {S} _ {4 }} $$

(14)

Если донор не подает сигнал в акцепторном канале и наоборот, что означает, что S3 и S4 равны 0, то этот шаг можно пропустить, и сигналы можно использовать сразу после коррекции фона.

Скорректированные донорные и акцепторные сигналы могут использоваться для отделения фактического сигнала FRET от спектрального просачивания в канале FRET, согласно Youvan et al .{c}} $$

(18)

Моделирование экспериментов FRET

Для моделирования экспериментов FRET мы создали математическую модель, основанную на обобщенной форме закона действия масс, которая описывает состояние всех химических взаимодействий в состоянии равновесия.

$$ A + B \ rightleftharpoons \ text {AB}, \, {K} _ {a} = \ frac {[AB]} {[A] \ ast [B]} $$

(19)

Состояние равновесия, а точнее, концентрации свободных и связанных фракций молекул, зависит от концентраций реагентов, а также их сродства, описываемого константой сродства K a (или ее обратной величиной, константа диссоциации K d ).K a — постоянное значение для реакции при указанной температуре и давлении. Для расчета FRET мы можем использовать наши донор и акцептор как A и B соответственно.

$$ {K} _ {a} = \ frac {[complex]} {{[don]} _ {free} \ ast {[acc]} _ {free}} $$

(20)

$$ [сложный] = [don] — {[don]} _ {free} = [acc] — {[acc]} _ {free} $$

(21)

Когда эти формулы объединены и решены для [комплекса], количество связанных и свободных частиц может быть определено при заданной общей концентрации донора, акцептора и значения K a .{2}} + [don] {K} _ {a} + \ frac {[acc]} {z} {K} _ {a} +1} {2 {K} _ {a}} $$

(24)

Важно отметить, что этот способ введения фактора стехиометрии подразумевает, что многочисленные молекулы донора или акцептора, которые появляются в комплексе, уже связаны друг с другом до взаимодействия между молекулами донора и акцептора. {c} \) и F ​​ c можно рассчитать, применив фиксированное значение максимальной эффективности FRET FRET max , которое представляет эффективность FRET, если все донорные и акцепторные молекулы были задействованы в донорно-акцепторном комплексе, а также спектральные коэффициенты просачивания S1, S2, S3 и S4.

$$ {D} _ {da} = {[don]} _ {free} + [complex] \ ast (1-FRE {T} _ {max}) + ({[acc]} _ {free} + [сложный]) \ ast {S} _ {4} $$

(26)

$$ {A} _ {da} = {[acc]} _ {free} + [complex] + (\, {[don]} _ {free} + [complex] \ ast (1-FRE {T } _ {max})) \ ast {S} _ {3} $$

(27)

$$ {F} _ {da} = [комплекс] \ ast FRE {T} _ {max} + S1 \ ast {D} _ {da} + S2 \ ast {A} _ {da} $$

(28)

Для вычислительного моделирования модель можно упростить, установив для S1, S2, S3 и S4 значение 0, что не влияет на математическое моделирование.

Из полученных значений были рассчитаны показатели FRET в соответствии с уравнениями с 16 по 18.

Подгонка результатов FRET

Для получения трех количественных переменных K a app , z и FRET max , мы модифицировали результаты наших измерений в имитационную модель. Чтобы напрямую использовать интенсивности донорного и акцепторного каналов, а также результирующий DFRET для подгонки, мы немного изменили формулу, чтобы получить меру FRET вместо концентрации комплекса.{app}} \ ast \ frac {FRE {T} _ {max}} {don} $$

(31)

Подгонка проводилась с помощью нелинейной модели наименьших квадратов, что сводило к минимуму отклонение теоретических и реальных значений за несколько итераций. Подгонка модели может быть непосредственно применена к измеренным значениям, но должна быть ограничена значимой областью около стехиометрии комплекса. Для простого взаимодействия 1: 1 мы применяем модель ко всем значениям с отношением акцептора к донору от 0,2 до 2.

Статистическая информация

Статистические значения для подгонки модели были определены с помощью нелинейного алгоритма подгонки наименьших квадратов программного обеспечения R. Статистическая информация (где применимо) и n чисел приведены на соответствующих рисунках или в подписях к рисункам.

Реализованное программное обеспечение и код

Все описанные расчеты и оценки могут быть выполнены в свободно доступных ( R, ImageJ, CytExpert, FlowPy ) или общих (Microsoft Excel) программных пакетах.

Расчеты FRET, оценка FRET и моделирование были выполнены в Microsoft Excel (версия 2013). Приведены примеры таблиц данных (дополнительные шаблоны 1 и 2), включая пояснения по использованию и образец набора данных (дополнительные рисунки 8–10).

Подгонка модели

была выполнена в R (https://www.r-project.org/) с использованием команд нелинейной аппроксимации методом наименьших квадратов. Предоставляется код, используемый для фитинга (дополнительное примечание 2).

Весь написанный код, который использовался в этой работе, включая полностью автоматизированные макросы ImageJ и последовательности R-кода, предоставляется в качестве дополнения или доступен на Github по адресу https: // github.com / BHochreiter.

Динамическая настройка FRET в биосенсоре зеленого флуоресцентного белка

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Кристаллическая структура Twitch-2B

Мы расшифровали структуру с разрешением 2,5 Å (таблица S1A). Асимметричный блок состоит из двух мономеров (рис. S1A). Они представляют идентичные конформации отдельных доменов [среднеквадратичные отклонения (RMSDs) ниже 0,2 Å] и несколько иную междоменную конформацию (RMSD 0,992 Å), но, по-видимому, не собираются как симметричный гомодимер.Их интерфейс (рис. S1B), покрывающий 630 Å 2 ( 11 ), на самом деле значительно меньше, чем интерфейс стабильного димера ( 12 ). Кроме того, данные малоуглового рентгеновского рассеяния (МУРР) показывают, что в растворе Twitch-2B является мономерным (рис. S2). Поэтому мы сфокусируем наше описание здесь на мономере A. Кристаллическая структура показывает расположение донора и акцептора относительно минимального кальций-связывающего домена TnC, а также структуру оптимизированных линкеров (рис.1). Структура кальций-связывающего домена очень похожа на C-концевой глобулярный домен куриного TnC (RMSD 0,84 Å) ( 13 ), на структуру ЯМР, решенную ранее ( 8 ), и на структуру кальмодулина. (RMSD 1,08 Å) ( 14 ). Основные оси двух бочкообразных доменов флуоресцентного белка ориентированы почти под перпендикулярным углом друг к другу. Стволы β практически не контактируют друг с другом (рис. 2А) с очень маленькой общей границей раздела (150 Å 2 ).Интерфейсы минимального кальций-связывающего домена с mCerulean3 и cpVenus cd также относительно невелики, покрывая только 257 и 351 Å 2 , соответственно (см. Ниже). Взаимодействия в основном носят гидрофильный характер (рис. 2А).

Рис. 2 Структурные детали Twitch-2B.

( A ) Полярные взаимодействия между остатками минимального домена TnC, mCerulean3 и cpVenus cd показаны пунктирными линиями. Остатки показаны в виде палочек.( B ) Полярные взаимодействия, опосредованные остатками (показаны в виде палочек) от линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также взаимодействия между cpVenus cd и кальций-связывающим доменом (пурпурный) . ( C ) Гидрофобные взаимодействия между остатками (показаны в виде палочек) линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также линкером между cpVenus cd и кальций-связывающим доменом (пурпурный) с остатками (серым цветом) из ядра минимального домена TnC.( D и E ) Крупный план области вокруг N532 Twitch-2B и мутанта N532F Twitch-2B (Twitch-6).

Линкер между mCerulean3 и кальций-связывающим доменом (V 232 ADA) образует спираль 3 10 , которая прочно удерживается на месте водородными связями основной цепи от V232 и S236 в mCerulean3 до E301 и E239 кальция. -связывающий домен (рис. 2Б). Далее линкер между кальций-связывающим доменом и cpVenus cd (P 305 IYPEL) образует полтора α-спиральных витка (рис.2, B и C), карбонилы основной цепи E309 и L310 образуют водородные связи с боковой цепью R551 (рис. 2B) cpVenus cd . Боковая цепь E309 также образует водородную связь с Y152 mCerulean3, плотно связывая три домена вместе. Остатки I306, Y307 и L310 этой короткой спирали участвуют в сети гидрофобных контактов (рис. 2C). Очевидно, что скрининг оптимальных линкеров ( 8 ) привел к последовательностям со спиральными элементами, очень хорошо интегрирующимися в структуру минимального домена TnC, в то время как эти линкеры удерживают на месте донорный и акцепторный домены в основном за счет полярных взаимодействий.

Расчет эффективности FRET на основе структуры

Структура предоставила важную информацию для расчетов FRET. Во-первых, расстояние между центрами масс флуорофоров составляет 3,65 нм (рис. 1B). Затем внутри структуры флуорофоры mCerulean3 и cpVenus cd выровнены в конфигурации «голова к голове». Таким образом, мы могли точно определить относительную ориентацию дипольных моментов флуорофоров (рис. 1C; см. Материалы и методы), которые доступны из расчетов теории функционала плотности ( 15 ).Используя эту объединенную информацию, мы рассчитали фактор ориентации κ 2 , равный 1,98 (уравнение 1; материалы и методы), и расстояние Ферстера, R 0 , 6,9 нм для mCerulean3 / cpVenus cd . Пара FRET (уравнение 3; материалы и методы). С этими параметрами, используя уравнение Фёрстера, E = R06 / (R06 + r6), теоретическая эффективность FRET, E , Twitch-2B была определена как 0,98. Эффективность FRET, экспериментально определенная с помощью деканшинга донора, равна 0.78 (рис. S3A), что значительно ниже, чем полученное из кристаллической структуры.

Два мономера Twitch-2B в асимметричном блоке (рис. S1A) не только имеют очень похожую конформацию (RMSD основной цепи 0,992 Å), но также образуют очень похожие контакты упаковки кристаллов (рис. S1C). Таким образом, мы делаем вывод, что ориентация доменов в мономере сама по себе не ограничивается кристаллической упаковкой, а в основном внутримономерными взаимодействиями, описанными выше (рис. 2А), и очень вероятно выбрана из пула уже существующих конформаций в растворе.Поскольку междоменные интерфейсы в мономере Twitch-2B относительно малы (рис. 2A), высокая гибкость решения может быть причиной наблюдаемого снижения эффективности FRET. Чтобы исследовать эту гипотезу, мы затем обратили внимание на передовые методы ЯМР.

ЯМР-исследование динамики биосенсора

Чтобы получить представление о возможной динамике, мы использовали парамагнитный ЯМР ( 16 ) с образцом Twitch-2B, где два сайта связывания кальция TnC были загружены диспрозием (Dy).Анизотропная магнитная восприимчивость комплекса TnC-Dy 2 индуцирует парамагнитный тензор выравнивания, который может быть определен из структуры ( 17 ) (см. Материалы и методы). Мы использовали спектрометры на 900 МГц и 1,1 ГГц, поскольку тензор юстировки квадратично зависит от магнитного поля. Если данный флуоресцентный белок является жестким по отношению к TnC, то тензор выравнивания, который он испытывает, идентичен TnC. Если, однако, флуоресцентный белок является динамическим по отношению к TnC, то это движение уменьшит тензор выравнивания первого ( 16 , 18 ).Это позволяет количественно оценить динамику флуоресцентных белков по отношению к TnC. В то время как диполярные связи усредняются в изотропном растворе из-за случайного изотропного переворачивания, парамагнитно-индуцированные тензоры выравнивания приводят к анизотропному распределению ориентации TnC и, следовательно, прикрепленных зеленых флуоресцентных белков в растворе, что приводит к неполному усреднению диполярного муфты, позволяющие наблюдать остаточные диполярные связи (RDC). Мы определили RDC метильных групп парамагнитно выровненного Twitch-2B ( 19 ) (см. Материалы и методы).Наблюдаемый диапазон RDC достаточен для измерения размера тензора выравнивания ( 20 ), так что отнесение метильных групп не было необходимым.

Мы обнаружили, что диапазон значений RDC и, таким образом, тензор выравнивания, испытываемый флуоресцентными белками, в 10 раз меньше, чем рассчитанные на основе жесткой рентгеновской структуры (рис. 3; см. Материалы и методы). Таким образом, динамика должна быть причиной несоответствия между расчетной и экспериментальной эффективностями FRET.Кристаллическая структура может быть только частью динамического конформационного ансамбля в растворе.

Рис. 3 Гистограммы парамагнитных данных RDC.

Прогнозирование RDC метильных групп в двух доменах флуоресцентного белка и TnC с использованием рентгеновской структуры (выделено пурпурным цветом). Тензор выравнивания, индуцированный двумя ионами диспрозия, связанными с TnC, является результатом трансляции тензора, полученного из кальмодулина (см. Материалы и методы). Экспериментальные RDC от парамагнитного ЯМР Twitch-2B (зеленый) и Twitch-6 (пурпурный).Дальность действия уменьшается в 10 и 5 раз для Twitch-2B и Twitch-6 соответственно.

Конструирование мутанта на основе структуры с улучшенной эффективностью FRET

Предполагая структурную целостность отдельных доменов, мы предположили, что линкерные области являются стержнем этой динамики. На границах раздела между доменом TnC и донорным и акцепторным доменами преобладают полярные взаимодействия (рис. 2А). Мы предположили, что замена этих взаимодействий гидрофобными контактами сделает линкеры жесткими и увеличит экспериментальную эффективность FRET.С этой целью мы разработали мутацию N532F (рис. 2, D и E) на поверхности cpVenus cd , создавая новое взаимодействие с F249 кальций-связывающего домена (рис. 2D). Как и ожидалось, эта мутация вызвала существенное увеличение максимального изменения отношения FRET с 800 до 1100% in vitro (рис. S4). В кристаллической структуре этого мутанта (Twitch-6; таблица S2) боковая цепь F532 действительно связывается в гидрофобный карман, образованный боковыми цепями F249, Asp262 и Y338 (рис. 2E).В остальном структуры Twitch-6 и Twitch-2B очень похожи (RMSD 0,25 Å), что приводит к почти идентичной теоретической эффективности FRET (см. Дополнительные материалы). Благодаря этой конструкции экспериментальная эффективность FRET Twitch-6 увеличилась до 0,90, с 0,78 для Twitch-2B (рис. S3B), а диапазон RDC, измеренных с Twitch-6, удвоился по сравнению с Twitch-2B (рис. 3). . Это указывает на сужение интерфейса между доменом TnC и cpVenus cd , и, таким образом, уменьшение динамики между доменами является причиной увеличения FRET.

Конформационные ансамбли в решении

Определив динамику как причину снижения эффективности FRET Twitch-2B в решении, мы хотели получить представление о конформационном пространстве, возникающем в результате этой динамики. Для этой цели мы выбрали конформационные ансамбли, исследующие динамику скелета исключительно на динамических линкерных областях между доменами флуоресцентного белка и доменом TnC (см. Материалы и методы), оценивая более 1 миллиона шестичленных ансамблей против наблюдаемых RDC и эффективности FRET (Таблица 1, рис.4 и Материалы и методы). Среди всех возможных ансамблей мы выбрали тот, который лучше всего воспроизводит как экспериментальную эффективность FRET, так и диапазон RDC (Таблица 1). Этот ансамбль полностью объясняет, как гибкость неупорядоченных остатков линкерных областей приводит к наблюдаемому снижению эффективности FRET и диапазона RDC.

Таблица 1 Результаты выбора ансамбля. Рис. 4 Ансамбли белков Twitch, согласующиеся с измеренными эффективностями RDC и FRET.

Ансамбли для Twitch-2B (слева) и Twitch-6 (справа) содержат по шесть структур каждый, причем самые большие отклоняющиеся структуры показаны зеленым и красным.Состояния, которые не являются этими крайними конформациями, прозрачны.

Влияние на улучшенную конструкцию датчика FRET

Таким образом, мы получили кристаллическую структуру флуоресцентного кальциевого биосенсора Twitch-2B и вместе с динамикой линкеров, определенной с помощью парамагнитного ЯМР, мы количественно оценили эффективность FRET. Поскольку динамика ограничивала эффективность FRET, мы успешно сконструировали ригидифицированный мутант с увеличенным FRET. Таким образом, структурные и динамические характеристики ратиометрических датчиков FRET обеспечили принципы проектирования, которые могут быть применимы к другим системам, в которых эффекты FRET используются для восприятия сигналов.

МАТЕРИАЛЫ И МЕТОДЫ

Клонирование, экспрессия и очистка Twitch-2B и Twitch-6

Конструкция Twitch-2B была описана ранее ( 8 ). Для настоящего исследования кодирующую последовательность трехдоменного слитого белка клонировали в модифицированный вектор pET16b, кодирующий слитый белок с N-концевой меткой His 7 и последовательностью расщепления, распознающей вирус травления табака (TEV). Мутант Twitch-2B N532F (Twitch-6) был создан с использованием набора для сайт-направленного мутагенеза QuikChange (Agilent).Экспрессионные конструкции pET16bTEV-Twitch-2B и pET16bTEV-Twitch-6 трансформировали в штамм Escherichia coli BL21 (DE3). Экспрессию белка проводили при 303 К индукцией 0,5 мМ изопропил-β-d-1-тиогалактопиранозидом. Клетки собирали через 7 часов после индукции. Меченный селенометионином белок Twitch-2B был сверхэкспрессирован в штамме B834 метионин-ауксотрофа E. coli в минимальной среде с добавлением (+) — l-селенометионина в соответствии с группой по экспрессии белка EMBL (Европейская лаборатория молекулярной биологии) (www.embl.de).

Осадок клеток из 1 литра встряхиваемой культуры ресуспендировали в 60 мл лизирующего буфера [20 мМ трис-HCl (pH 7,9), 300 мМ NaCl, 20 мМ имидазол, 0,5 мМ фенилметилсульфонилфторид с одной таблеткой полного количества ЭДТА- свободных ингибиторов (Roche) на 100 мл лизирующего буфера]. Клетки лизировали ультразвуком с последующим центрифугированием при 27000 g и 277 К. Из супернатанта рекомбинантный белок очищали с помощью аффинной хроматографии с иммобилизованным металлом на 3 мл агарозной смолы Ni-нитрилотриуксусной кислоты (NTA) (Qiagen).Метку слияния His 7 отщепляли протеазой TEV и удаляли инкубацией с 1 мл Ni-NTA агарозной смолы. Белок диализовали против 20 мМ трис (pH 7,0) и 150 мМ NaCl. После доведения концентрации сульфата аммония в растворе белка до 1 М белок дополнительно очищали хроматографией на гидрофобном взаимодействии на колонке с фенилсефарозой объемом 10 мл (GE Healthcare). Белок элюировали с этой колонки 50-мл градиентом от 1 до 0 М сульфата аммония.Фракции, содержащие белок, объединяли и концентрировали до объема 2,5 мл с помощью концентратора для ультрафильтрации с MWCO (пороговая молекулярная масса) 30 кДа (Vivascience). Наконец, белок очищали эксклюзионной хроматографией на гель-фильтрационной колонке HiLoad 26/60 Superdex 200 мкг. Фракции пика объединяли, диализовали против 20 мМ трис-HCl (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 , и концентрацию белка доводили до 20 мг / мл.

Флуоресцентная спектроскопия

Для спектроскопии рекомбинантного Twitch-2B in vitro белок был очищен от E.coli с использованием смолы Ni-NTA, как описано ( 6 ). Спектроскопию выполняли на спектрофотометре Cary Eclipse (Varian). Донорское расщепление Twitch-2B проводили путем расщепления Twitch-2B в связанном с кальцием состоянии в течение ночи при комнатной температуре с химотрипсином (70 Ед / мл; Sigma-Aldrich) при записи FRET. Небольшое оставшееся излучение cpVenus cd после переваривания химотрипсина было избирательно фотообесцвечено (5 мин) с помощью массива из шести светодиодов Luxeon Lumiled с пиком на длине волны 530 нм, с общей рассеиваемой мощностью 14.7 Вт и 870 люмен. Для защиты mCerulean3 от обесцвечивания использовали LP (длиннопроходный) фильтр с длиной волны 500 нм. Связанный с кальцием Twitch-6 был очень устойчив к расщеплению протеазой. Следовательно, EGTA (конечная концентрация, 5 мМ) добавляли во время переваривания химотрипсина, чтобы получить спектр деквенированного mCerulean3.

Кристаллизация, сбор данных и определение структуры

Кристаллы Twitch-2B и Twitch-6 были получены путем диффузионного смешивания паров 1 мкл раствора белка с 1 мкл раствора для лунок [0.2 M Na-формиат (pH 7,0), 5 мМ CaCl 2 и 18-20% полиэтиленгликоля 3350]. Кристаллы были подвергнуты криозащите, перенеся их в хорошо раствор с добавлением от 16 до 18% глицерина на 1 мин и быстро охладив, погрузив их в жидкий азот.

Сбор данных производился в PXII, SLS, Швейцария, с использованием детектора PILATUS 6M (Dectris). Собственные данные собирали при 100 К на длине волны 1 Å. Данные по производному селенометионина были измерены при 0,98 Å. Все данные были обработаны с помощью программного обеспечения для детектора рентгеновских лучей (XDS) ( 21 ) и масштабированы с помощью SADABS (Bruker AXS).Определение пространственной группы и статистический анализ выполняли с использованием XPREP (Bruker AXS). Фазирование выполняли с помощью AutoSol ( 22 ).

Первоначальная модель была построена с помощью AutoBuild и дважды уточнена с помощью phenix.refine ( 23 ) с промежуточным ручным построением модели с помощью Coot ( 24 ). Окончательная модель была получена путем комбинированного ручного отслеживания (Coot) и уточнения с использованием Refmac5 ( 25 ). На графике Рамачандрана 96,69% ​​остатков располагались в предпочтительной области 2.72% в разрешенной области и 0,58% остатков были выбросами. Кристаллическая структура Twitch-6 была решена с помощью PHASER ( 26 ), используя PDB (Protein Data Bank) запись 6GEL в качестве модели поиска. Построение и уточнение модели выполнялись, как описано для Twitch-2B. Для этого мутанта 96,68% остатков попали в предпочтительную область графика Рамачандрана, 2,83% попали в разрешенную область и 0,49% были выбросами.

Расчеты FRET

Фактор ориентации κ 2 может быть извлечен из структурной информации следующим образом: κ2 = (cos θT — 3 cos θD cos θA) 2 (1) где θ T — угол между эмиссионным переходом диполь донора и диполь перехода поглощения акцептора; θ D и θ A — углы между этими диполями и вектором r , соединяющим донорный и акцепторный флуорофоры ( 27 ).Ориентация дипольных моментов перехода относительно вектора связи C O (ω) в градусах ωD = 73 ° ωA = 76 ° была взята из Ansbacher et al. ( 15 ), а угловые параметры были извлечены из кристаллографических координат в угловых единицах θT = 152,95 ° θD = 149,17 ° θA = 26,79 °

Подробные вычисления объяснены в файле данных S1. Интеграл перекрытия, Дж, (λ), был рассчитан из экспериментальных спектров поглощения и излучения изолированных доменов cpVenus и mCerulean3 соответственно (рис.S5) со сценарием Python, включенным в качестве дополнительной информации. J (λ) был определен как 2,052 × 10 15 M −1 см −1 нм 4 , следующим образом: J (λ) = ∫0∞FD (λ) εA (λ) λ4dλ = ∫0∞FD (λ) εA (λ) λ4dλ∫0∞FD (λ) dλ (2) где F D (λ) — нормированная интенсивность флуоресценции донора в диапазоне длин волн от λ до λ + Δλ. ε A (λ) — коэффициент экстинкции акцептора при λ.

Расстояние Ферстера, R 0 , можно рассчитать на основе ранее полученных экспериментальных параметров R0 = 0.211 (κ2n − 4QDJ (λ)) 1/6 (3) где Q D (0,87) — квантовый выход донора в отсутствие акцептора ( 4 ) и n , (1,33) показатель преломления водной среды.

Наконец, эффективность передачи энергии, E , может быть рассчитана как отношение скорости передачи к общей скорости распада донора в присутствии акцептора E = R06R06 + r6 (4)

Следуя этой процедуре, эффективность FRET была определена как E = 0.979, из кристаллографической структуры Twitch-2B. Эквивалентный расчет, выполненный со структурой мутанта Twitch-6, дает E = 0,983 (см. Файлы данных S1 и S2).

ЯМР-спектроскопия

Мы экспрессировали белки Twitch-2B и Twitch-6 в минимальной среде Toronto, приготовленной из 100% D 2 O и пердейтерированной d-глюкозы и дополненной предшественниками аминокислот α-кетомасляной кислотой (метил-13C , 3,3-D2) и α-кетоизовалериановой кислоты (3-метил-13C, 3,4,4,4-D4), таким образом, селективно мечение атомами 13 C и 1 H только метильных групп остатки валина, лейцина и изолейцина, сохраняя при этом остальные атомы C как 12 C и протоны как 2 H ( 19 ).

Сначала были получены спектры изотропных образцов в буфере A [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 в 100% D 2 O]. Затем белки диализовали против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ EDTA] с последующим диализом против буфера C [20 мМ Mops (pH 7,0) и 100 мМ NaCl] и, наконец, заменяли на буфер С, приготовленный на 100% D 2 O, содержащем три эквивалента диспрозия, перед измерениями ЯМР. Концентрация белка в образцах составляла примерно 0.5 мМ.

Образцы были протестированы с помощью экспериментов с метил-TROSY ( 19 , 28 ) (рис. S7) при 900 МГц и 1,1 ГГц, а связи J и J + RDC были определены с использованием J -модулированного Эксперимент с метил-TROSY ( 29 ), изображенный на рис. S6 в виде матриц 2048 × 128 комплексных точек данных с 96 переходными процессами на приращение ( t 1 ). Общие использованные задержки модуляции J были следующими: 4, 6, 8, 10, 12, 14, 16, 18 и 20 мс (рис.S8). ЯМР-эксперименты проводили с использованием 5-мм TCI (криозонда тройного резонанса с инверсным детектированием) на спектрометре 900 МГц и криозонда TCI 3 мм на спектрометре 1,1 ГГц, оба оснащены консолями NEO (Bruker). Интенсивности (максимальная амплитуда) сигналов были извлечены с помощью CARA (компьютерное определение резонанса) ( 30 ) в экспериментах с обработкой NMRPipe ( 31 ) и проанализированы с помощью скриптов Python (рис. S8), следуя Pederson et al. ( 29 ).

Расчет парамагнитного тензора

Мы взяли парамагнитный тензор из комплекса кальмодулин-IQ, связанного с диспрозием, из ( 18 ) и рассчитали суммарный тензор дважды занятого кальцийсвязывающего домена TnC. Сайт связывания кальция 1 TnC перекрывается с сайтом связывания лантанидов кальмодулина (CaM N60D). Мы повернули матрицу выравнивания с сайта связывания кальция из CaM на второй сайт связывания кальция TnC и добавили его к тензору сайта связывания кальция 1, таким образом получив общий тензор TnC.Затем этот тензор использовался для расчета RDC из парамагнитных белков Twitch ACaM = (1,05 10−31−1,92 10−322,04 10−31−1,92 10−32−1,22 10−316,46 10−322,04 10−316,46 10−321,67 10−32 ) ATwitch = (1,46 10-318,39 10-323,46 10-318,39 10-32-1,06 10-312,26 10-323,46 10-312,26 10-32-3,92 10-32)

Тензоры даны в м 3 M −1 .

Генерация ансамбля

Сначала мы индивидуально смоделировали все возможные двугранные углы основной цепи (ϕ и ψ; выборка с шагом 60 °) линкерных остатков (от Arg 229 до Gln 231 для mCerulean3 и Met от 311 до Gly 313 ​​ для cpVenus), что не привело к стерическому конфликту между одним из модифицированных доменов флуоресцентного белка и доменом TnC.Каждую из двух линкерных областей моделировали независимо. Из всех возможных комбинаций ϕ, ψ (117 649) вращение mCerulean3 привело к 477 возможным конформациям, в то время как cpVenus допустил 84 конформации, обеспечивая в целом 40 086 возможных конформаций.

Во-вторых, мы случайным образом объединили возможные структуры для mCerulean-TnC и TnC-cpVenus в ансамбли из шести членов. Мы произвольно отобрали 1 миллион шестичленных ансамблей из 40 068 возможных ϕ, ψ комбинаций линкеров между mCerulean и TnC и между TnC и cpVenus, чтобы гарантировать правильное исследование конформационного пространства Twitch.

В-третьих, мы рассчитали диапазон RDC (используя тензор, полученный, как описано выше) и FRET ансамблей и сравнили их с экспериментальными значениями, определив коэффициент качества ансамбля Qens = ∑i = 1i = 6 (RDCi − RDCeRDCe) 2+ (FRETi-FRETeFRETe) 2, где RDC i — диапазоны распределения, субиндекс e указывает экспериментальное значение, а i указывает значение из члена ансамбля. Такое значение добротности отличается от 0, если совпадения предсказанных откликов RDC и FRET от ансамбля отклоняются от экспериментальных данных, и 0 в случае полного совпадения.Наконец, ансамбли были отсортированы по их Q ens , и был выбран самый низкий из них.

Измерения SAXS

Данные SAXS были собраны на канале BM29 Европейского центра синхротронного излучения (ESRF) в Гренобле, Франция, с использованием автоматического устройства смены образцов ( 32 ). Белок диализовали либо против буфера A [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 ] (связанное с кальцием состояние), либо против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ ЭДТА] (без кальция).Перед измерением белок центрифугировали для удаления более крупных частиц. Образцы измеряли при концентрациях 2,5, 10 и 20 мг / мл. Буфер для диализа использовали для коррекции эталонного буфера. Данные собирали при 293 К с использованием длины волны 0,995 Å и расстояния от образца до детектора 2,867 м. Загружали сто микролитров каждой концентрации образца, собирали и объединяли 10 кадров. Образцы непрерывно подавались в кювету, чтобы свести к минимуму эффекты радиационного повреждения.Изображения детектора были объединены и преобразованы в одномерные кривые рассеяния, а вклады буфера в рассеяние были вычтены с использованием программного обеспечения BsxCuBE. Дальнейшая обработка данных выполнялась автоматически с использованием онлайн-конвейера EDNA ( 33 ) для оценки качества образца и эффектов радиационного повреждения. Агрегации белков или радиационного повреждения не наблюдалось.

Данные были дополнительно проанализированы с помощью программного пакета ATSAS ( 34 ). Вкратце, первичная обработка и анализ данных были выполнены с использованием программ PRIMUS ( 35 ) и GNOM ( 36 ).

Теоретическое рассеяние от кристаллической структуры было рассчитано с использованием программы CRYSOL ( 37 ) (рис. S2), а молекулярные массы рассчитаны с использованием образца бычьего сывороточного альбумина в качестве стандарта.

Благодарности: Мы благодарим персонал компании SLS, X10SA за поддержку при сборе рентгеновских данных и ESRF, BM29 за поддержку при сборе данных SAXS. Мы благодарим M. Paulat, C. Schwiegk и A. Moritz за техническую помощь в производстве белка и K.Оверкамп для масс-спектров электроспрея. С. благодарит T. Gruene и G. Sheldrick за советы по уточнению кристаллической структуры и структурному анализу. К.Г. и П.Т.-М. поблагодарить R. Kuemmerle (Bruker Biospin) за измерения ЯМР на частоте 1,1 ГГц. Источник: Эта работа была поддержана Обществом Макса Планка и DFG SFB 870 (O.G.). П.Т.-М. был поддержан докторской стипендией Гумбольдта. Вклад авторов: P.T.-M. выполнен ЯМР. П.Т.-М. и К.Г. разработал парамагнитный метод ЯМР.П.Т.-М. рассчитаны структурные ансамбли. П.Т.-М. и С. выполнены измерения SAXS. К.Г. рассчитал FRET по рентгеновским структурам. T.T. и O.G. определили экспериментальные эффективности FRET. С. кристаллизовал Twitch-2B и Twitch-6 и решил кристаллические структуры. Рукопись написана всеми авторами. С. разработал проект. Конкурирующие интересы: Авторы заявляют, что у них нет конкурирующих интересов. Доступность данных и материалов: Структуры депонированы с кодом 6GEL для биосенсора Twitch-2B и 6GEZ для мутанта Twitch-2B N532F (Twitch-6).Все данные, необходимые для оценки выводов в статье, представлены в документе и / или дополнительных материалах. Дополнительные данные, относящиеся к этой статье, могут быть запрошены у авторов.

Датчик FRET движения С-конца выявляет активацию VRAC посредством передачи сигналов DAG плазматической мембраны, а не ионной силы

[Примечание редакции: план авторов по исправлениям был одобрен, и авторы подали официальную пересмотренную заявку.]

Учитывая список важных изменений, включая новые эксперименты, редакторы и рецензенты приглашают вас ответить в течение следующих двух недель с планом действий и графиком завершения дополнительной работы.Мы планируем поделиться вашими ответами с рецензентами, а затем выпустить обязательную рекомендацию.

Три рецензента согласны с тем, что основная проблема в этой статье заключается в отсутствии подтверждения электрофизиологией данных FRET. Очень важно проводить одновременные эксперименты, измеряя FRET и ток в ответ на активирующие стимулы. Если это выходит за рамки ваших технических возможностей, по крайней мере, такие же эксперименты по измерению FRET должны быть повторены электрофизиологами.Также важно, чтобы данные FRET и визуализации были представлены в более четкой форме и чтобы эксперименты PKC FRET также подтверждались электрофизиологией. Более подробный список комментариев см. В отчете рецензентов ниже.

Как мы описываем в приведенном ниже ответе по пунктам, мы стремились решить все эти вопросы. Мы провели флуорометрию патч-зажим для одновременного измерения FRET и токов, продемонстрировав связь изменения сигнала FRET с активацией VRAC.Мы улучшили представление наших данных и экспериментальных методов. Кроме того, мы провели электрофизиологические эксперименты и одновременные измерения FRET / тока, чтобы исследовать механизм активации VRAC. Тем самым мы подтвердили роль диацилглицерина. Вместо PKC мы смогли определить роль PKD в активации VRAC, используя объединенную мощность электрофизиологии и нашего датчика FRET. Кроме того, мы неожиданно обнаружили артефакты, связанные с конфигурацией целых клеток, которые остались бы не обнаруженными без нашего оптического инструмента.

Рецензент № 1:

В этой статье группы Stauber представлены результаты экспериментов, в которых они измерили сигнал FRET между присоединенной парой флуоресцентных белков в белках LRRC8A или E, которые образуют регулируемые по объему каналы VRAC. Измерения показывают, что сигнал FRET модулируется применением гипотонических растворов. Авторы утверждают, что сигнал связан с активацией канала VRAC, и представляют дополнительные экспериментальные доказательства того, что активация также опосредуется активацией фосфорилирования PKC.Экспериментальные методы адекватны, и в целом выводы подтверждаются доказательствами.

Мы благодарим рецензента за эти положительные комментарии.

Есть несколько моментов, которые необходимо изложить более четко. В частности, хотя есть доказательства того, что сигнал FRET специфичен для LRRC8, авторы цитируют несколько обзоров в качестве доказательства того, что сигнал FRET коррелирует с динамикой активации VRAC тем же стимулом. Однако доказательства в этих ссылках показывают, что активация VRAC стимулами фиксации напряжения происходит в мс-шкале времени, и не показаны данные о динамике реакции на гипертонический стимул.Авторам необходимо показать параллельный эксперимент, показывающий величину тока VRAC, продуцируемого LRRC8A / A и LRRC8A / E в их конкретной системе экспрессии.

Следуя предложениям рецензентов, мы выполнили флуорометрию с помощью патч-зажима, чтобы одновременно измерить FRET и токи LRRC8A-CFP / E-YFP в клетках HEK293, дефицитных по эндогенному VRAC. Эти измерения продемонстрировали, что временной ход изменений FRET коррелировал с текущей активацией и инактивацией при применении гипотонического буфера и последовательного изотонического буфера (новый рисунок 1F).Это заменяет цитирование обзоров на данной позиции. Пока нам не удалось измерить токи от гомомерных каналов LRRC8A / A — возможно, из-за чрезвычайно низкой проводимости (Gaitán-Peñas et al., 2016; Deneka et al., 2018).

Эксперименты с фиксацией напряжения показывают, что токи VRAC деактивируются в ответ на продолжительный приложенный стимул. Важно обсудить устойчивый характер сигнала FRET, если он связан с активацией канала. Считается ли, что для каждой модальности активации канала существуют разные ворота?

Как также видно из наших одновременных измерений FRET / тока, сигнал FRET (уменьшенный FRET, коррелирующий с активным VRAC) следует за токами (которые мы измеряем при -80 мВ).Устойчивая активность VRAC при гипотоничности не является чем-то необычным как в режиме фиксации напряжения целых клеток (например, обзор Pederson et al., 2016 и показанный на их рисунке 1A), так и в клетках, не подвергнутых фиксации с помощью заплатки целых клеток (как видно из многочисленных примеров). эксперименты по изучению VRAC-опосредованного оттока осмолита). Зависящая от времени инактивация нефизиологическими деполяризованными напряжениями типична для токов VRAC (кинетика инактивации и зависимость от напряжения меняются в зависимости от состава субъединицы LRRC8 — Voss et al., 2014, Ullrich et al., 2016). Мы наблюдали инактивацию этой характеристики в наших протокольных измерениях скачка напряжения, которые мы обычно проводили, чтобы подтвердить, что измеряемые нами токи опосредованы VRAC (новый рисунок 1F и новый рисунок 4C). Вероятно, существуют разные ворота для активации / инактивации за счет осмолярности и инактивации, вызванной деполяризацией, но обсуждение этого выходит за рамки данного исследования.

Рецензент № 2:

Для редакторов

Авторы разработали очень интересный анализ для мониторинга активности LRRC8-опосредованных каналов VRAC с использованием чисто оптического анализа на основе FRET.Такой анализ может быть полезен для исследований структуры-функции, а также для изучения функции VRAC в физиологических условиях. Однако основная критика заключается в том, что анализ не был подтвержден параллельными электрофизиологическими измерениями. Если авторы могут предоставить такое подтверждение, я бы поддержал публикацию.

Благодарим рецензента за в целом положительные комментарии. Следуя предложениям рецензентов, мы выполнили серию электрофизиологических измерений, также параллельно с нашим анализом FRET.

Авторам

В рукописи König et al. Описан метод мониторинга активности чувствительных к объему каналов VRAC / LRRC8 с разрешением во времени и пространстве путем измерения внутрикомплексного FRET между слитыми с С-концом флуоресцентными белками. Преследуются две основные цели: во-первых, продемонстрировать гибкость доменов с богатыми лейцином повторами (LRRD) и их участие в закрытии канала; во-вторых, чтобы предоставить доказательства того, что низкая внутриклеточная ионная сила не является физиологически значимым параметром для открытия VRACs.Скорее авторы предполагают, что активация при гипотонической стимуляции связана с активностью PKC.

Кроме того, авт. Используют анализ, чтобы показать, что LRRC8-обеспечиваемый VRAC не активируется в эндомембранах, а только в плазматической мембране.

Ключевые вопросы, лежащие в основе работы, заслуживают похвалы и потенциально очень важны для данной области. В частности, метод введения внутримолекулярного датчика FRET расстояния до субъединиц является весьма инновационным и потенциально очень полезным.Возможность контролировать активность LRRC8 с помощью чисто оптического анализа очень интригует.

Мы благодарим рецензента за эти положительные комментарии. Действительно, теперь мы видим главное преимущество чисто оптического анализа — мы не диализируем клетку и не теряем сигнальные пути.

Однако для полной валидации анализа необходимо несколько технических контролей. Что наиболее важно, обязательно, чтобы сам анализ и другие результаты подтверждались электрофизиологическими данными.

Все эксперименты должны быть дополнены электрофизиологическими записями. В принципе, было бы наиболее убедительно, если бы анализ FRET мог быть выполнен на той же клетке, которая была закреплена заплатой, чтобы убедиться, что изменения FRET отражают текущую активацию. Поскольку это может быть технически слишком сложно, необходимо, по крайней мере, проверить конструкции, используемые при электрофизиологических записях, в тех же условиях, что и анализ FRET. Присоединение флуоресцентных белков к С-концу может изменить «чувствительность к объему» само по себе.Фактически, добавление флуоресцентных белков к С-концу приводит к конститутивной активности анионных каналов в ооцитах Xenopus (Gaitán-Peñas et al., 2016).

Как было предложено авторами обзора, мы выполнили флуорометрию с помощью патч-зажима и измерили FRET и ток в тех же клетках. Мы обнаружили, что (как ранее описано Gaitán-Peñas et al., 2016) меченые конструкции давали остаточные токи в изотоничности. Тем не менее, токи явно усиливались гипотоничностью (как показывают измерения в ооцитах, проведенные Gaitán-Peñas et al., 2016). Это сделало измерения действительно технически сложными (со сверхэкспрессией клеток ниже 20% по сравнению с более чем 50% успешных результатов в клетках дикого типа), как также заявили Gaitán-Peñas et al., 2016: «Однако мы обнаружили это. быть чрезвычайно трудным из-за очень низкого уровня успешности образования гига-уплотнения. В нескольких успешных записях можно было наблюдать конститутивную VRAC-подобную активность каналов (данные не показаны) ». Тем не менее, с помощью флуориметрии патч-кламп мы смогли убедительно подтвердить связь наблюдаемых изменений FRET с активацией VRAC.

Авт. Предполагают центральную роль PKC в закрытии канала и указывают, что его фармакологическое ингибирование предотвращает открытие VRAC, управляемое гипотонией. Опять же, этот результат должен быть подтвержден электрофизиологическими записями с использованием тех же конструкций и конструкций без метки — необходимо количественное сравнение плотности тока с применением и без применения PMA / Gö6983 / стауроспорина.

Мы сначала подтвердили, что PMA также вызывает снижение cFRET в HEK293 в дополнение к клеткам HeLa (новая правая панель на рисунке 4A) и что изменения cFRET были специфичными для VRAC, поскольку неродственный датчик FRET (CFP-18aa-YFP) не действовал. ответить на PMA (новый рисунок 4 — приложение к рисунку 1A).Впоследствии мы провели электрофизиологические эксперименты на клетках, сверхэкспрессирующих наши конструкции LRRC8 с флуоресцентной меткой, и на клетках дикого типа с эндогенным VRAC, чтобы исследовать роль киназ, активированных DAG (и PMA).

Примечательно, и сначала в явном противоречии с нашими результатами измерений FRET, мы обнаружили, что PMA не активировал VRAC в зажатых клетках (новый рисунок 4B). Приложение PMA не повлияло ни на текущую, ни, что удивительно, на cFRET.Однако, когда мы инкубировали клетки с PMA перед установлением конфигурации целых клеток, мы обнаружили активацию флуоресцентно-меченного VRAC и эндогенного VRAC, как показано на новом рисунке 4C. Таким образом, мы могли бы подтвердить наши данные cFRET электрофизиологическими методами и впервые продемонстрировать, что цельноклеточная фиксация клеток влияет на передачу сигналов в пути активации VRAC, возможно, посредством клеточного диализа. Электрофизиологические измерения дополнительно подтвердили ингибирующий эффект DOG (ингибитор киназы DAG) на инактивацию VRAC после гипотонии как для флуоресцентно меченных LRRC8, так и для эндогенного VRAC (новый рисунок 5C), подтверждая роль передачи сигналов DAG в активации VRAC.

Наши попытки подтвердить влияние Gö6983 на cFRET электрофизиологическими измерениями привели к парадоксальным результатам. В клетках, содержащихся в цельноклеточной конфигурации патч-зажим, мы наблюдали огромное увеличение cFRET в четыре раза, что мы просто не можем объяснить. Параллельно Gö6983 не ингибировал токи VRAC, фактически искажая предполагаемую роль PKC в активации VRAC. В самом деле, мы бы упустили этот момент, если бы не проводили контрольные электрофизиологические эксперименты, предложенные тремя рецензентами.Мы соответствующим образом изменили все соответствующие утверждения в рукописи. Вместо этого применение Gö6983 уменьшило инактивацию токов, когда мы изменили буфер с гипотонического на изотонический. Мы показываем эти данные на новом Рисунке 4 — в приложении 2, но не делаем однозначных выводов.

Исключив PKC в качестве основного медиатора активации VRAC диацилглицерином (или PMA), мы протестировали PKD, которая также может быть привлечена к мембране и активирована DAG (и PMA). В отличие от Gö6983, ингибитор PKD CRT 0066101 уменьшал индуцированные гипотонией токи VRAC как во время зажима, так и при применении до прорыва мембраны (новый рисунок 5A, B).

Рецензент № 3:

Анионные каналы с регулируемым объемом (VRAC) играют центральную роль в модуляции объема клеток у животных, обеспечивая выход ионов хлора и более крупных осмолитов из клетки при активации в гипотонических условиях и, следовательно, противодействуя набуханию клеток. Эти каналы представляют собой гетерогексамеры, состоящие из обязательной субъединицы LRRC8A и дополнительных субъединиц LRRC8-B-E. Механизм активации VRAC не изучен, но было высказано предположение, что он связан с конформационными изменениями на его С-конце, и было показано, что он запускается снижением ионной силы в восстановленной системе.В настоящей рукописи Бенджамин Кениг и его сотрудники конструируют основанный на FRET датчик активности VRAC путем слияния С-концов различных субъединиц с любым из двух флуоресцентных белков, способных к FRET. Авторы показывают изменения FRET в ответ на гипотоническую среду, которые являются обратимыми при возвращении к изотоническим условиям, с кинетикой и фармакологией, которые согласуются с сигналом, происходящим от активации VRAC. Они также показывают, что обусловленные гипотоничностью изменения FRET происходят только для каналов в плазматической мембране, тогда как те, которые расположены во внутриклеточных компартментах (ER и golgi), не обнаруживают изменений в FRET.Они демонстрируют, что требование активности локализации в плазматической мембране не связано с различиями в концентрации холестерина или целостностью актинового цитоскелета. Напротив, авторы обнаружили, что стимуляция активности PKC приводит к заметным изменениям FRET, подобным тем, которые производятся гипертонической средой, тогда как ингибирование PKC предотвращает изменения FRET в ответ на гипотоническую среду. Авторы разработали набор умных инструментов для отслеживания активности VRAC, не требуя электрофизиологических измерений, и предоставляют релевантную информацию о физиологических условиях клетки, которые обеспечивают активность VRAC, и о роли С-конца в активации канала.Однако я думаю, что рукопись была бы намного сильнее, если бы авторы предоставили более прямые доказательства того, что изменения FRET действительно связаны с активацией канала. Кроме того, они должны устранить некоторые очевидные несоответствия в своих наблюдениях, а также в отношении опубликованных данных, а также предоставить дополнительную информацию о некоторых экспериментах.

Благодарим рецензента за в целом положительные комментарии. Мы рассмотрели опасения рецензента, как описано ниже.

У меня есть следующие конкретные проблемы:

1) Все выводы в рукописи основаны на предположении, что наблюдаемые изменения FRET отражают активацию канала.Однако доказательства, подтверждающие это, не являются прямыми, а скорее зависят от коррелятивных наблюдений за эффектами неспецифических методов лечения, которые также могут влиять на другие процессы в клетке. Возможно, что изменения FRET отражают конформационное изменение, независимое или, по крайней мере, частично независимое от активации. Этот вопрос особенно важен, учитывая, что роль С-конца в активации не установлена. Я думаю, что рукопись была бы значительно сильнее, если бы авторы могли предоставить более прямые доказательства этого, выполнив электрофизиологические измерения в сочетании с измерениями FRET, или используя дополнительные специфические ингибиторы VRAC, или проведя эксперименты с потерявшими функцию субъединицами VRAC.

Как было предложено рецензентами, сейчас мы выполнили электрофизиологические измерения одновременно с измерениями cFRET. Новые результаты демонстрируют четкую корреляцию изменений cFRET с токами VRAC. Это показывает, что датчик FRET является полезным инструментом для изучения активности VRAC и что С-концы перемещаются во время активации VRAC. Мы не претендуем на строгую роль C-конца в активации VRAC.

2) Одним из основных наблюдений в статье является то, что для наблюдаемых изменений FRET и активации каналов требуется локализация в плазматической мембране.Однако существует значительное количество внутриклеточно расположенных субъединиц LRRC8 даже без обработки BFA (см., Например, LRRC8E-RFP на рисунке 2C), и сигналы FRET, зависящие от гипотоничности, показанные на рисунке 1, по-видимому, исходят из всей клетки (см. Рисунок 1D). Авторы должны устранить это очевидное противоречие и предоставить подробную информацию о том, как они выполняли свой анализ для измерения сигналов, в основном исходящих от плазматической мембраны. Наблюдение, что LRRC8E, по-видимому, в большей степени удерживается в ER, чем LRRC8A (см. Рисунок 2C), по-видимому, противоречит наблюдению о том, что соотношение 8A / 8E не коррелирует с наблюдаемыми изменениями FRET, за исключением случаев, когда большая часть измеренного сигнала FRET происходит из плазматической мембраны.Авторы должны обсудить эти вопросы.

Благодарим рецензента за поднятие этой проблемы. В самом деле, часть любой субъединицы LRRC8 часто застревает в секреторном пути, как мы наблюдали ранее для экзогенно экспрессируемых комбинаций LRRC8 (Voss et al., 2014). Количество сигнала, не поступающего от плазматической мембраны, показало высокую вариабельность, при этом некоторые клетки показали много LRRC8A, а некоторые клетки LRRC8E внутриклеточно. Обычно существует тенденция к тому, что LRRC8E больше застревает в эндомембранной системе, но, что важно, мы не наблюдали корреляции с уровнями экспрессии.Поскольку VRAC могут принимать различные стехиометрии субъединиц, это указывает на то, что количество правильно спаренных (и задействованных) субъединиц также не зависит от уровней экспрессии. Соответственно, мы не наблюдали корреляции между абсолютными нормализованными по акцепторам значениями cFRET и уровнями экспрессии LRRC8E (не показаны). Действительно, сигнал YFP, исходящий из части ячейки с небольшим CFP (LRRC8A), не будет вносить вклад в реальный сигнал FRET правильно сформированных каналов VRAC (см. Отсутствие совместной локализации на рисунке 2C), но он действительно снизит акцептор -нормализованный cFRET (см. уравнение в разделе «Материалы и методы»).Однако, поскольку мы не наблюдали корреляции между уровнями экспрессии и внутриклеточной локализацией, нет никакой корреляции между соотношением экспрессии 8A / 8E и снижением cFRET (Рисунок 1 — приложение к рисунку 2B). Мы согласны с рецензентом, что это важный вопрос, который заслуживает пояснения в рукописи, и поэтому добавили соответствующее утверждение (подраздел «Межсубъединичный FRET показывает движение С-конца во время активации VRAC»).

3) Авторы должны обсудить очевидное противоречие своих данных с наблюдениями в реконструированной системе, где пониженная ионная сила достаточна для активации каналов VRAC.

В самом деле, Syeda et al., (2016) наблюдали активацию комплексов LRRC8, восстановленных в бислоев мембран за счет пониженной ионной силы. До сих пор у нас нет объяснения этому очевидному противоречию, за исключением среды VRAC, то есть системы искусственных мембранных двух слоев по сравнению с клеточным контекстом. В клеточном контексте, однако, есть несколько исследований, подтверждающих активацию VRAC без изменения ионной силы. Кроме того, изменения ионной силы, необходимые для активации VRAC, обычно не достигаются в экспериментах с использованием конфигурации целых клеток для изучения VRAC.Недавно это было подробно рассмотрено Стрэнджем и др. (2019). Следуя предложению рецензента, мы расширили наше обсуждение этого вопроса, добавив также дополнительные цитаты из важных исследований регулирующей роли ионной силы в активации VRAC (раздел «Обсуждение»).

4) Из изображений на Рисунке 3B я не могу определить, какие каналы локализованы в ER по сравнению с Гольджи, даже несмотря на то, что авторы использовали маркер для экспрессии Гольджи. Авторы должны использовать маркеры ER, Гольджи и плазматической мембраны, а также предоставить полуколичественный анализ, чтобы продемонстрировать расположение различных популяций каналов, а также предоставить более подробное описание того, как они выбрали свои области интереса для выполнения группового анализа каналов в каждом из каналов. клеточные отсеки.

Мы добавили изображения (новый рисунок 3 — приложение к рисунку 1), показывающие совместную локализацию LRRC8A-CFP-FM2 с маркером ER ER-YFP, маркером Гольджи GalNAc-RFP и с CD4-YFP в качестве маркера плазматической мембраны. после выхода из блока агрегации. Мы предоставляем полуколичественный анализ репрезентативной клетки, в которой мы прослеживаем конструкцию LRRC8A-CFP-FM2 через секреторный путь (Рисунок 3 — видео 1; количественные данные показаны для каждого временного интервала), для которого мы измеряем интенсивность флуоресценции CFP в область Гольджи и ROI для плазматической мембраны (изображено на видео).Мы добавили более подробное описание выбора ROI в подраздел «Система обратной агрегации».

5) На рисунке 1 — приложение к рисунку 1, авторы должны показать чистый FRET, а не нормализованные значения, чтобы читатели могли увидеть, насколько вариативность FRET была между элементами управления и VRAC.

Чистые значения FRET для наших флуоресцентно меченных субъединиц VRAC сильно различались, при этом измеренная эффективность FRET составляла от 10% до 80%.Вероятно, это связано с гибкой стехиометрией субъединиц гексамерных комплексов VRAC, по крайней мере, при экзогенной экспрессии LRRC8 (например, Gaitán-Peñas et al., 2016). Соответственно, cFRET (то есть скорректированное значение FRET, нормализованное к уровню акцептора) варьировалось в популяции клеток, что требовало нормализации значений. Относительное снижение cFRET во время активации VRAC не зависело от чистого FRET данной клетки, точно так же, как оно не коррелировало с соотношением экспрессии субъединиц (см. Точку 2 и рисунок 1 — приложение к рисунку 2B).Поэтому мы решили не показывать чистые значения FRET, поскольку это не добавит ценной информации. Однако теперь мы указываем вариабельность FRET как причину для нормализации (подраздел «Акцепторное фотообесцвечивание, сенсибилизированное излучение и ратиометрические анализы FRET»). Чистые значения FRET для контрольных конструкций FRET (CFP-18aa-YFP и GluA2-6Y-10C), с другой стороны, показали небольшую вариабельность между клетками, но мы также представляем их как нормализованные значения для ясности.

6) Авторы должны показать, влияет ли лечение LatB или MbCD на чистые уровни FRET, а не только на нормализованные значения.

Чистые значения FRET сильно различаются в зависимости от объясненных ячеек (см. Наш ответ на пункт 5). Среднее значение этого сильно изменчивого значения не изменилось обработкой LatB или MbCD: мы наблюдали среднее (ненормализованное) cFRET 52 ± 15% (необработанные клетки в изотоническом буфере), 45 ± 17% (LatB) и 47 ± 12% (МБКД). Мы предпочитаем не представлять эти данные в рукописи, так как считаем, что они не предоставят дополнительную полезную информацию.

7) Аннотация, заголовок и весь текст, по-видимому, подразумевают, что активация PKC связана с физиологической активацией VRAC при воздействии гипотонических растворов.Однако представленные данные на самом деле не устанавливают связь между стимуляцией VRAC PKC и изменениями внеклеточной осмолярности. Вполне может быть, что PKC-стимулированные VRAC действительно активируются ионной силой, и что эта чувствительность скрывается за счет ингибирования PKC. Авторы должны предоставить более подробное обсуждение того, как PKC может влиять на активность канала, даже если оно основано только на предположениях.

Этот аспект рукописи существенно изменился после новых измерений патч-зажима и осознания того, что PKC не так важен, как мы предполагали.Вместо этого мы демонстрируем гораздо более сильную связь с передачей сигналов DAG-PKD, потому что мы можем активировать, ингибировать или поддерживать токи VRAC в отсутствие или в противовес гипотоничности.

https://doi.org/10.7554/eLife.45421.024

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

границ | Конверсия цитохрома P450 2D6 человека в инструмент на основе FRET для мониторинга аймалицина в живых клетках в реальном времени

Введение

Аджмалицин, природный монотерпеноидный алкалоид индола, представляет собой биоактивное соединение, хорошо известное своей антигипертензивной и антимикробной активностью (Moreno et al., 1995; Дас и Сатьяпракаш, 2018). Он также используется для снятия обструкции церебрального кровотока и продемонстрировал свой потенциал при лечении болезней системы кровообращения (Misra et al., 2006). Адренергическая блокировка и центральная депрессивная активность этого алкалоида была оценена Бхаргавой и Борисоном (1957). Сообщалось также о цитотоксической активности аджмалицина (Dey and De, 2012). Ранее предполагалось, что аджмалицин, наряду с другими гетероохимбиновыми алкалоидами, действует как предшественник различных оксиндольных алкалоидов, которые проявляют множество биологических активностей (Stavrinides et al., 2016). Кора корня R. serpentina и C. roseus , являющихся значительными источниками аджмалицина, была неизбирательно использована для экстенсивного извлечения аджмалицина из-за его высокого спроса (Zheng and Wu, 2004; Mallick et al., 2012; Fulzele, Namdeo, 2018). Кроме того, низкое содержание алкалоидов в растениях требует использования природных источников в больших количествах. В то же время значительное истощение природных источников исследовало вопрос, вызывающий озабоченность окружающей среды (Zafar et al., 2019). Следовательно, требуется устойчивое и увеличенное производство за счет тщательного изучения метаболических взаимодействий, участвующих в синтезе алкалоидов. Предыдущие попытки повысить продуктивность аджмалицина с помощью клеточных суспензионных культур, культур во встряхиваемых колбах, культур волосатых корней, методов выявления и лабораторных подходов к масштабированию, несомненно, способствовали повышению урожайности (Schlatmann et al., 1993; ten Hoopen et al., 1994; Альмагро и др., 2010). Однако возможность реализации достижений в более крупном масштабе сталкивается с трудностями, связанными с непомерно высокими затратами и трудозатратами.Учитывая нынешние блокады на пути повышения продуктивности алкалоидов, флуксомическое исследование могло бы щедро разрешить проблему, определив регуляторные элементы, влияющие на поток в метаболическом пути. Флюксомный подход к мониторингу динамики аджмалицина in vivo и может быть многообещающим в области исследований для понимания сложного взаимосвязанного клеточного метаболизма и может справедливо устранить препятствия, связанные с его низким выходом и производством. Возможность контролировать поток аджмалицина в реальном времени может быть предложен наносенсором FRET, разработанным в настоящем исследовании.Это обещает обеспечить высокое пространственное и временное разрешение при изучении потока аджмалицина. На сегодняшний день наносенсоры FRET были успешно разработаны для in vivo исследования различных аналитов, таких как лизин (Ameen et al., 2016), глицин бетаин (Ahmad et al., 2016), цинк (Mohsin et al., 2015 ), глюкозу (Fehr et al., 2003), глутамат (Okumoto et al., 2005) и рибозу (Lager et al., 2003). Учитывая потребность в инструменте, который может выполнять поток аджмалицина в живой системе в реальном времени, в этом исследовании был разработан генетически кодируемый наносенсор на основе FRET.

Наносенсоры FRET следуют общей конструкции, состоящей из сэндвича с анализируемым специфическим лиганд-связывающим белком между донорными и акцепторными флуоресцентными белками. Выбор лиганд-связывающего белка осуществляется на основе его способности претерпевать конформационные изменения в присутствии целевого аналита. Измененная конформация связывающего лиганд белка путем связывания целевого аналита приводила к передаче безызлучательной энергии от донорного флуоресцентного белка к акцепторному флуоресцентному белку (пара FRET), демонстрируя измененную интенсивность излучения флуорофоров.Наносенсор использует переменную интенсивность излучения в качестве меры изменения концентрации метаболита, помогая в исследовании потока. Прелесть этих генетически закодированных наносенсоров на основе FRET заключается в том, что мониторинг метаболитов может выполняться в любом типе клеток и многократно.

Материалы и методы

Разработка химерной конструкции

Человеческий цитохром P450 2D6, связывающий аймалицин белок, был использован в качестве элемента для связывания аджмалицина для разработки наносенсора.Структура белка была проанализирована с использованием RCSB PDB (PDB ID-4WNT, разрешение 2,6 Å), и нуклеотидная последовательность гена (CYP2D6), кодирующего белок, была получена из KEGG (KEGG Entry-1565). КДНК человеческого CYP2D6 была приобретена у Sinobiologicals Inc., и амплификация гена была достигнута с использованием набора из двух праймеров: 5′- accggt cccctggccgtgatagtggccatctt-3 ‘(FP) и 5’- ccggt ctagcggggcacagcacaaa (RP), содержащий сайты рестрикции Age I, обозначенные здесь курсивом.Кроме того, вектор pDh28 был использован для амплификации нуклеотидных последовательностей ECFP и Венеры, причем праймеры были сконструированы для добавления сайтов attB 1 и attB 2 на 5′-конце ECFP и 3′-конце Венеры, соответственно. Затем сайты рестрикции Age I, содержащие ген CYP2D6, лигировали между 3 ‘концом ECFP и 5’ концом Венеры, получая химерную последовательность ECFP_CYP2D6_Venus, клонированную в векторе pGEM-Teasy (Promega, США). Затем рекомбинантную химерную последовательность вводили в вектор pRSET B (Novagen, Германия) рестрикционным расщеплением по сайтам Bam HI и Hin dIII.Разработанная рекомбинантная конструкция pRSET-B_ECFP_CYP2D6_Venus была обозначена как FLIP-Ajn (флуоресцентный индикаторный белок аймалицина). Клонированную конструкцию дополнительно вводили в векторы экспрессии дрожжевых (pYES-DEST52), растительных (pEarleyGate100) и животных клеток (pCDNA-DEST-40) с использованием технологии клонирования Gateway (Invitrogen, США). Первоначально pRSET-B_ECFP_CYP2D6_Venus был перемещен к pDONR222 в реакции рекомбинации, опосредованной BP, для создания входного клона (pDONR222_ECFP_CYP2D6_Venus).PDONR222_ECFP_CYP2D6_Venus был дополнительно переведен на pYES-DEST52, pEarleyGate100 и pCDNA-DEST-40, генерирующие клоны экспрессии, pYES-DEST52_ECFP_CYP2D6_Venus, pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus, с использованием реакции pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus-mediated response. Для проверки рекомбинационных конструкций был принят анализ секвенирования (рисунок S1).

Экспрессия и очистка наносенсорного белка

Конструкцию FLIP-Ajn трансформировали в клетки Escherichia coli BL21 (DE3) и оставляли для роста при 21 ° C в течение 24 часов для экспрессии.Рост клеток продолжался до O.D. 600 ~ 0,6. Впоследствии экспрессия была инициирована добавлением синтетического аналога аллолактозы — изопропил-β-D-1-тиогалактопиранозида (IPTG). Индуцированные клетки выдерживали в шейкере инкубатора при 21 ° C в течение 48 ч, колбу накрывали и помещали в темные условия. Затем культуру центрифугировали при 4500 × g при 4 ° C в течение 15 минут и растворение осадка выполняли с помощью 20 мМ трис-Cl (pH 7,5). После этого была проведена обработка клеток ультразвуком для высвобождения белка наносенсора.Белок наносенсора был отделен от клеточного дебриса центрифугированием при 7800 об / мин в течение 30 мин. Сначала супернатанту давали связываться с Ni-NTA агарозной смолой (Qiagen, Германия) в течение 3 ч в чашке Петри и выдерживали при 4 ° C. Затем белок дважды промывали в аффинной колонке с меткой Ni-NTA His ледяным буфером, содержащим 20 мМ трис-Cl, pH 7,5 и 20 мМ имидазол. Наконец, элюцию белка проводили 20 мМ трис-Cl, pH 7,5 и 250 мМ имидазолом, и хранили для дальнейшего исследования.

Характеристики нанодатчика

Характеристику наносенсора проводили с помощью микропланшетного ридера (Synergy h2, Biotek, США). Первоначально спектральный анализ наносенсора проводился путем измерения интенсивности излучения ECFP и Венеры. ECFP подвергали возбуждению с длиной волны 430 нм, и излучение регистрировали посредством спектрального сканирования между 450 и 600 нм с интервалом 10 нм в присутствии и в отсутствие аджмалицина. После спектрального анализа были изучены зависимость от pH, специфичность и сродство наносенсора.Фильтры / щели, используемые для анализа, были 430 нм / 20 нм для возбуждения ECFP, 485 нм / 20 нм для испускания ECFP и 540 нм / 20 нм для испускания Венеры. Элюированный белок разводили в 20 раз в различных буферных системах, а именно, Tris-Cl, PBS, TBS и MOPS в диапазоне pH 5,5–7,5 для анализа зависимости pH и оптимальной буферной системы для характеристики наносенсора. Тестирование специфичности разработанного наносенсора проводили путем добавления 10 мМ различных ингибиторов / субстратов CYP2D6 к FLIP-Ajn.Эти соединения представляли собой резерпин, резциннамин, винбластин, винкристин, хинидин, серпентин, тиоридазин и хинин. Сродство наносенсора осуществляли путем титрования белка наносенсора при различных концентрациях аджмалицина. Значение, полученное из отношения интенсивностей излучения Венеры / ECFP (отношение FRET) при связывании лиганда, обеспечивает меру концентрации субстрата. Аффинность связывания аджмалицина (значение K d ) определяли, применяя следующее уравнение к кривым титрования лиганда:

S = (r — r апо ) / (r sat — r apo ) = [L] / ( K d + [L]), где S означает насыщение; [L] для концентрации аджмалицина; r для соотношения; r апо представляет собой соотношение без аймалицина и r сат с аджмалицином.

Мониторинг аймалицина в реальном времени

Бактериальные клетки

Разработанную рекомбинантную конструкцию pRSET-B_ECFP_CYP2D6_Venus (FLIP-Ajn) вводили в клетки E.coli BL21 (DE3) и выращивали при 37 ° C (150 об / мин) в шейкере-инкубаторе до достижения O.D. 600 бактериального роста достигло 0,6. Затем клетки обрабатывали 0,5 мМ IPTG и выдерживали в течение 24 часов при 21 ° C при непрерывном встряхивании для экспрессии белка наносенсора. Мониторинг содержания аджмалицина в бактериальных клетках в реальном времени осуществляли путем добавления 10 мМ аджмалицина к бактериальной культуре, помещенной в многолуночные планшеты.Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 30 минут, а данные собирались каждые 5 минут. Контрольный эксперимент включает бактериальные клетки без аджмалицина. Используемые фильтры / щели возбуждения были такими же, как описано в предыдущем анализе.

Дрожжевые клетки

Клонированный шлюзом pYES-DEST_ECFP_CYP2D6_Venus был трансформирован в штамм BY4247 Saccharomyces cerevisiae / URA3 . Трансформированные дрожжевые клетки культивировали в синтетической среде определенного (SD), содержащей декстрозу (2%) в качестве источника углерода и галактозу (1%) для индукции.Экспрессированные дрожжевые клетки подвергали конфокальному микроскопическому анализу с использованием сканирующей головки Leica TCS-SPE и линзы объектива 63x с системой масляной иммерсии. В экспрессированную культуру вводили 10 мМ аджмалицина. Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 10 мин, а данные собирались каждые 20 с.

Клетки животных

Клетки HEK-293T (эмбриональная почка человека) культивировали в среде Игла, модифицированной Дульбекко, содержащей 50 мкг / мл ампициллина, 10% фетальной телячьей сыворотки и CO 2 , в шейкере-инкубаторе при 37 ° C.Опосредованную фосфатом кальция временную трансфекцию клеток HEK-293T с помощью pCDNA_ECFP_CYP2D6_Venus проводили в 6-луночном культуральном планшете и давали возможность экспрессироваться в течение 2 дней. Промывочный буфер состоял из 50 мМ NaCl, 1 мМ MgCl 2 , 5 мМ KCl, 5 мМ D-глюкозы и 25 мМ HEPES (pH 7,2–7,4). После перерыва в 2 дня после трансфекции культивированные клетки были настроены для анализа изображений с использованием конфокального микроскопа с числовой апертурой 1,53, охлаждаемой камеры с зарядовой связью и иммерсионного объектива 63x.В культуру добавляли 10 мМ аджмалицина и снимали изображения. Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 10 мин. Настройка лазера, используемая для анализа, была одинаковой как для дрожжевых, так и для животных клеток. Данные собирались через интервал в 20 с, а время экспозиции, установленное для получения изображений, составляло 300 мс.

Растительные клетки

Эксплантаты листьев были использованы в исследовании для инициации каллуса. Сегменты листьев Catharanthus roseus были собраны из травяного сада Джамия Хамдард, Нью-Дели.Затем собранные эксплантаты промывали непрерывно в течение 20 мин под водопроводной водой. Затем эксплантаты обрабатывали 0,5% цетримидом и 0,1% HgCl 2 в течение 10 и 5 минут соответственно. Далее проводили последовательную промывку 70% спиртом и стерилизованной дистиллированной водой в течение 1 мин. Культивирование стерильных эксплантатов проводили на среде MS (Murashige and Skoog, 1962), содержащей 0,5 мкМ 2,4-D, 3% сахарозы и 0,62% агара. PH среды поддерживали на уровне 5,65, а пробирки для культивирования хранили в культуральной комнате при 25 ± 2 ° C.

Agrobacterium tumefaceins штамм EHA105 трансформировали pEarleyGate100_ECFP_CYP2D6_Venus, и культивирование суспензии инициировали после инокуляции одной колонии трансформированного штамма Agrobacterium в среду LB. В среду добавляли 50 мг / мл канамицина и 50 мг / мл рифампицина, и культуру поддерживали при 28 ° C в течение 36 часов. Затем осуществляли трансформацию каллусных клеток, добавляя линии каллуса, хранящиеся в культуральной комнате, к суспензионной культуре клеток агробактерий.Культуре позволяли расти при 28 ° C (150 об / мин) до OD. 600 0,6. Затем эксплантаты сушили с помощью стерильной фильтровальной бумаги и совместно культивировали в течение 3 дней на МС + 100 мкМ ацетосирингон при 25 ± 2 ° C. После этого эксплантаты промывали сначала цефотаксимом 500 мг / л, а затем дважды стерильной дистиллированной водой. Им снова давали высохнуть и затем переносили в среду отбора, содержащую MS, 10 мг / л BASTA, 250 мг / л цефотаксима и 0,5 мкМ 2,4-D. Впоследствии цефотаксим и антибиотик были дополнительно удалены из среды, и культура поддерживалась при 16-часовом фотопериоде при 25 ± 2 ° C.

Суспензионную культуру Catharanthus roseus , трансформированную pEarleyGate100_ECFP_CYP2D6_Venus, наблюдали под конфокальным микроскопом Leica с 10-кратным объективом. Культуру подвергали флуоресцентному анализу, и соотношение интенсивностей эмиссии Венеры / ECFP регистрировали после возбуждения при 430 нм. Визуализация осуществлялась с использованием отдельных фильтров возбуждения и излучения. Использовали фильтр возбуждения 430 нм, а для исследования использовали фильтры излучения 485 нм и 540 нм.Для регистрации отношения интенсивностей излучения FRET использовалась программа LAS-AF (Leica, Германия).

Развитие аффинных мутантов

Для расширения физиологического диапазона наносенсора аминокислоты лиганд-связывающего кармана аймалицин-связывающего белка были точечно мутированы с использованием набора для сайт-направленного мутагенеза с быстрой заменой (Stratagene, США). Точечные мутации были внесены в разные сайты. Фенилаланин в положении 120 был заменен аргинином (F120R), лизин в положении 213 был заменен аланином (L213A), глицин в положении 212 был заменен глутамином (G212Q), а аспарагиновая кислота в положении 301 была заменена глицином (D301G).Очистку экспрессии и анализ аффинности разработанных мутантов проводили, как описано в предыдущем разделе.

Результаты

Проектирование и изготовление нанодатчика

Цитохром P450 2D6 был успешно преобразован в сенсорный домен аджмалицина. Связывание аджмалицина с сайтом связывания лиганда белка индуцировало структурные изменения в белке и способствовало безызлучательному переносу энергии между флуоресцентной парой, ECFP и Венерой.N- и C-конец CYP2D6 был присоединен к флуоресцентным фрагментам (ECFP и Venus) для удовлетворения потребности в FRET (Рисунок 1). Успешная разработка рекомбинантной конструкции в векторах экспрессии, включая pRSET-B, была подтверждена посредством рестрикционного переваривания, как показано на фигурах S1-S11, и дальнейшее подтверждение было достигнуто с помощью анализа нуклеотидного секвенирования (фигуры S1, S13).

Рисунок 1 . Схематическое изображение конструкции наноснор. (A) Эскиз построенного нанонаносенсора. (B) Схема, описывающая работу FLIP — Ajn. Реакция FRET наблюдается после введения аджмалицина в систему.

Спектральный анализ нанодатчика

Экспрессия белка наносенсора была подтверждена с помощью спектрального анализа. Повышенная интенсивность излучения Венеры была зарегистрирована в присутствии 1 мМ аджмалицина (рис. 2). В отсутствие аджмалицина интенсивность излучения 140 и 200 а.е. регистрировали при 480 и 540 нм соответственно.Аналогичным образом, данные флуоресцентного анализа, полученные при добавлении аджмалицина к белку наносенсора, показали снижение интенсивности излучения на 120 а.е. около 480 нм и повышенной интенсивности флуоресценции до 230 а.е. около 540 нм (рисунок 2). Изменение соотношения интенсивностей эмиссии Венеры / ECFP в присутствии и в отсутствие аджмалицина само по себе означало наличие FRET между ECFP и Венерой.

Рисунок 2 . Интенсивность излучения флуоресценции регистрировали на микропланшетном ридере в отсутствие и в присутствии 1 мМ аджмалицина.Показано улучшение интенсивности флуоресценции Венеры.

Эксперимент по титрованию, проведенный с белком наносенсора и аджмалицином в диапазоне от наномолярного до миллимолярного, показал насыщение белка повышенной концентрацией аджмалицина. Сигмоидальная кривая была получена с помощью графика данных, где увеличение отношения FRET от 0,7 до 1,05 наблюдалось при увеличении концентрации аджмалицина, а насыщение белка регистрировалось с помощью 1 мМ аджмалицина (фиг. 3).Аффинность связывания лиганда ( K d ) FLIP-Ajn была рассчитана как 582 мкМ. Концентрация белка наносенсора составила 0,20 мг / мл.

Рисунок 3 . Сигмоидальный график представляет насыщение FLIP-Ajn при увеличении концентрации аджмалицина. Эксперимент проводили с тремя независимыми повторами. Вертикальные полосы показывают стандартную ошибку набора данных.

Анализ стабильности pH наносенсора

Анализ стабильности pH in vitro подтвердил отсутствие влияния pH на ожидаемый выход белка наносенсора.Белок наносенсора был стабилен во всех буферах, выбранных для анализа, а именно, Tris-Cl, PBS, TBS и MOPS. Однако лучший результат был получен в буфере PBS (pH 7,0). Очищенный белок не показал изменений в соотношении FRET с показателем около 1,1 в отсутствие аджмалицина. Однако после добавления аджмалицина в буферную систему PBS была зафиксирована заметная разница в соотношении FRET. Не наблюдалось значительного изменения соотношения FRET от pH 5,5 до pH 7,0 (рис. 4).

Рисунок 4 .На рисунке показан анализ pH-стабильности FLIP-Ajn. Очищенный белок растворяли в буфере PBS с различным pH и отслеживали изменение соотношения FRET. Черная и желтая линии показывают соотношение FRET, определенное в присутствии и в отсутствие аджмалицина (Ajn). Построенные на графике значения представляют собой среднее значение трех независимых повторов. Вертикальные полосы указывают стандартную ошибку.

Анализ специфичности нанодатчика

Элюированный белок наносенсора, подвергнутый анализу специфичности, показал значительное изменение отношения FRET в присутствии аджмалицина по сравнению с контролем.Коэффициент FRET 1,1 был зарегистрирован для белка наносенсора при добавлении 10 мМ аджмалицина. Не было обнаружено значительного изменения соотношения FRET для FLIP-Ajn при добавлении различных субстратов / ингибиторов CYP2D6 (рис. 5), за исключением присутствия хинидина и серпентина, где изменение соотношения FRET составляло ~ 0,12 и ~ 0,14 относительно контроля. . Однако это несущественно, так как изменение отношения FRET <0,2. Этот анализ подтвердил специфичность CYP2D6 в отношении одного аджмалицина.

Рисунок 5 .Анализ лигандной специфичности FLIP-Ajn. Повышенное соотношение FRET по сравнению с контролем, наблюдаемое для одного аджмалицина. Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

Мутанты FLIP-Ajn

Четыре мутанта FLIP-Ajn были разработаны с разным сродством с помощью сайт-направленного мутагенеза. Различные наносенсоры обладают разной аффинностью связывания и имеют широкий диапазон концентраций от 24 мкМ до 4500 мкМ (таблица 1).Аффинность связывания ( K d ) для наносенсора дикого типа (WT) была рассчитана как 582 мкМ. Аналогичным образом были рассчитаны константы связывания мутантов. K d значения для F120R, L213A, G212Q и D301G были рассчитаны как 700, 3000, 38 и 24 соответственно. Максимальные изменения отношения FRET 0,52 наблюдались в F120R (Рисунок 6).

Таблица 1 . Аффинные мутанты FLIP-Ajn.

Рисунок 6 . Сигмоидальный график представляет собой насыщение наносенсора дикого типа (WT) и аффинных мутантов наносенсора (F120R, L213A, G212Q и D301G) при увеличении концентрации аджмалицина.Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

Мониторинг потока аджмалицина в прокариотических и эукариотических системах в реальном времени

Прокариотические (бактерии) и эукариотические (дрожжи и животные) системы, выбранные для мониторинга потока аджмалицина в реальном времени, показали повышенное соотношение FRET в присутствии аджмалицина. В бактериальных клетках после внешнего добавления аджмалицина наблюдалось увеличение отношения FRET с 0,2 до 0,4 (рис. 7).Точно так же данные конфокальной визуализации, полученные для потока аджмалицина в дрожжевых клетках в реальном времени, показали увеличение отношения FRET с 0,65 до 1,61 в течение 10 минут после добавления аджмалицина в культуру (рис. 8). Трансфицированные клетки HEK-293T также показали изменение отношения FRET от 0,4 ± 0,05 в 0 с до 0,85 ± 0,05 через 400 с после добавления аджмалицина, а данные визуализации показали распределение белка наносенсора в основном в цитоплазме культивируемых растений. ячеек (рисунок 9). Клетки Catharanthus roseus , трансформированные pEarleyDate100_ECFP_CYP2D6_Venus, экспрессируются в цитозоле растительных клеток.Медленное и последовательное добавление аджмалицина к суспензионной культуре привело к увеличению отношения FRET с 0,7 до 3,9 (фиг.10). Не наблюдалось значительного увеличения соотношения FRET в отсутствие аджмалицина, но добавление более высоких концентраций аджмалицина давало данные с высокими изменениями соотношения FRET. Изменившееся соотношение интенсивности излучения свидетельствует о поглощении аджмалицина растительными клетками.

Рисунок 7 . Динамика аймалицина в клетках бактерий в живых клетках.Линейный график показывает увеличение отношения FRET на ~ 0,24 после добавления 10 мМ аджмалицина. Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

Рисунок 8 . Мониторинг потока аджмалицина в дрожжевых клетках. (A) Конфокальные изображения дрожжевых клеток, экспрессирующих наносенсорный белок. Изображения представляют собой ECFP, Венеру и объединенную флуоресценцию. (B) Интенсивности испускания FRET FLIP-Ajn, экспрессированного в дрожжевых клетках.Повышенное соотношение FRET ~ 1 зарегистрировано при добавлении 10 мМ аджмалицина.

Рисунок 9 . Мониторинг потока аджмалицина в клетках млекопитающих. (A) Конфокальная визуализация трансформированных FLIP-Ajn клеток млекопитающих, отображающая изображения яркого поля, ECFP и Венеры. (B) Изменение соотношения FRET, наблюдаемое в трансформированных клетках HEK-293T. Увеличение соотношения FRET с 0,4 до 1,08 зафиксировано при добавлении аджмалицина в культуру.

Рисунок 10 .Изменение соотношения FRET в трансформированных клетках Catharanthus roseus , экспрессирующих наносенсорный белок. Сообщается о значительном увеличении интенсивности излучения Венеры в течение 20 минут.

Обсуждение

Предпосылки генетически кодируемого наносенсора FRET требуют конформационной гибкости лиганд-связывающего белка, которая должна быть достаточной, чтобы вызывать перенос энергии между прикрепленными флуорофорами (Fehr et al., 2002). Цитохром P450 2D6 связывается с аджмалицином, что приводит к изменению открытой структуры белка в результате образования водородной связи Glu-216 с аджмалицином, как сообщалось Wang et al.(2015). Структурные изменения решетки цитохрома P450 2D6 с аджмалицином и без него отражены в дополнительном файле. Об ингибирующем влиянии аджмалицина и серпентина на CYP2D6 впервые сообщили Usia et al. (2005). Работа FRET-наносенсора не зависит от активности CYP2D6 из-за ингибирующих эффектов аджмалицина, серпентина и различных субстратов / ингибиторов, выбранных для исследования. Для работы наносенсора необходимы только конформационные изменения CYP2D6 при связывании аджмалицина, независимо от результирующей ферментативной активности белка.Конформационные различия, возникающие в связывающем аджмалицин белке из-за добавления аджмалицина, были достаточными для индукции FRET между ECFP и Венерой, как показано на рисунке 2. Хотя тиоридазин, хинидин и хинин вызывают конформационные изменения в домене CYP2D6, как сообщает Ван. и другие. (2015), изменение соотношения FRET, наблюдаемое в присутствии этих субстратов, не было значительным, поскольку изменение соотношения FRET составляет <0,2 (Рисунок 5). Возникновение FRET также зависит от выбора донорных / акцепторных флуорофоров.Пара флуорофоров должна иметь достаточное спектральное перекрытие для эффективной передачи энергии, но при этом иметь тривиальные различия в спектрах, чтобы их можно было отличить друг от друга (Held, 2005). Связывание аджмалицина с цитохромом P450 2D6 согласовывало ECFP и Венеру, что приводило к безызлучательному переносу энергии между флуоресцентной парой, что наблюдалось по измененной интенсивности излучения пары FRET. Измерение соотношения FRET, основанное на интенсивности излучения донорных и акцепторных флуорофоров, ранее проводилось для мониторинга аминокислот (Hu et al., 2017), в исследовании также делается вывод об отсутствии помех pH, налагаемых на аффинность наносенсора, что делает его пригодным для мониторинга уровня аймалицина in vivo . Исследование также подтверждает специфичность наносенсора только для аджмалицина, что подтверждается значительным увеличением отношения FRET для FLIP-Ajn в присутствии аджмалицина (рис. 5).

FLIP-Ajn доказал свою превосходную способность контролировать уровень аджмалицина в реальном времени. Белок наносенсора успешно экспрессируется в клетках бактерий, дрожжей, животных и растений, и ожидаемое изменение соотношения FRET, наблюдаемое в исследуемых системах, подтвердило успешную разработку наносенсора.Одной из приоритетных задач разработанного наносенсора было обнаружение динамики метаболитов с высоким пространственным и временным разрешением в живых клетках. В целом, FLIP-Ajn продемонстрировал свою экспрессию в цитозоле дрожжевых клеток и цитоплазме клеток животных, как показано на фиг. 8, 9. FLIP-Ajn также успешно экспрессировался в цитозоле растительных клеток. Дальнейшее добавление нацеливающих последовательностей к наносенсорному белку позволит визуализировать различные субкомпоненты клеток и повысит нашу способность контролировать путь, участвующий в производстве аджмалицина.Нацеливание наносенсорного белка на субклеточные компартменты ранее достигалось с помощью ряда FRET-наносенсоров, а именно, FLIPglu в ядрах (Fehr et al., 2004). Созданные мутанты FRET-наносенсора также расширили возможности обнаружения наносенсора и, следовательно, обеспечивают его полезность для измерения уровней аджмалицина в широком физиологическом диапазоне.

Заключение

В исследовании сообщается о развитии белка-индикатора флуоресценции аймалицина посредством сэндвича CYP2D6 между парой FRET (ECFP и Venus).Было обнаружено, что наносенсор стабилен при pH ≥ 7,0, специфичен для аймалицина, т.е. не реагирует на выбранные ингибиторы / субстраты CYP2D6, а аффинность связывания белка наносенсора была рассчитана как 582 мкМ. Экспрессия наносенсорного белка была продемонстрирована в клетках E. coli BL21, Saccharomyces cerevisiae / URA3 штамма BY4247, клетках эмбриональной почки человека (HEK-293T) и суспензионных клетках Catharanthus roseus с помощью флуоресцентного анализа в присутствии аджмалицин.В ходе исследования также были разработаны различные мутанты CYP2D6 посредством сайт-направленного мутагенеза, в результате чего был получен набор наносенсоров с различной аффинностью связывания, которые были бы эффективны для измерения уровней аджмалицина в широких диапазонах концентраций. Наносенсор на основе FRET для аджмалицина, FLIP-Ajn, оказался полезным инструментом в изучении потока аджмалицина в живых клетках в реальном времени. Экспрессия наносенсора в четырех различных хозяевах, представляющих прокариотические и эукариотические микроорганизмы, а также в клетках животных и растений, успешно использованных в исследовании, позволила контролировать поток метаболита.Неинвазивность и высокое пространственное и временное разрешение инструмента имеют большое значение в био-визуализации сильно разветвленных метаболических путей. Присоединение сигнальных пептидов к наносенсору для экспрессии в определенных компартментах растительных клеток откроет новые двери в понимании сложного пути, действующего в природе. Изучение потока аджмалицина также поможет в определении регуляторных этапов, участвующих в синтезе алкалоида, и, следовательно, эффективно повысит скорость производства аджмалицина из его природных источников.

Заявление о доступности данных

Все наборы данных, созданные для этого исследования, включены в статью / дополнительные материалы.

Взносы авторов

GA, AA и MA предусмотрели и разработали эксперименты. GA и AA провели эксперимент. GA, AAA и EA проанализировали данные. GA, AA, AAA, AH, MA и EA подготовили рукопись. Все авторы читали и одобрили окончательный вариант рукописи.

Финансирование

Плата за публикацию оплачивается фондом деканата научных исследований Университета Короля Сауда за поддержку номера исследовательской группы (RGP-271).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

GA благодарен Совету по научным и промышленным исследованиям, Govt. Индии для младшего научного сообщества. AAA, AH и EA хотели бы выразить свою искреннюю признательность деканату научных исследований Университета короля Сауда за финансирование исследовательской группы номер (RGP-271).

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fbioe.2019.00375/full#supplementary-material

Список литературы

Ахмад, М., Амин, С., Сиддики, Т. О., Хан, П., и Ахмад, А. (2016). Мониторинг глицин бетаина в живых клетках с помощью генетически кодируемого наносенсора на основе FRET. Biosens. Bioelec. 86, 169–175. DOI: 10.1016 / j.bios.2016.06.049

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Альмагро, Л., Перес, А. Л., и Педреньо, М. А. (2010). Новый метод увеличения продукции аджмалицина в культурах клеток, основанный на использовании циклодекстринов. Biotechnol. Lett. 33, 381–385. DOI: 10.1007 / s10529-010-0430-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Амин С., Ахмад М., Мохсин М., Куреши М. И., Ибрагим М. М., Абдин и др. (2016). Разработка, создание и характеристика генетически закодированного нанонаносенсора на основе FRET для мониторинга потока лизина в живых клетках в реальном времени. J. Nanobiotechnol. 14:49. DOI: 10.1186 / s12951-016-0204-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бхаргава, К. П., и Борисон, Х. Л. (1957). Сравнительные эффекты различных алкалоидов Rauwolfia на центрально вызванные вазопрессорные реакции. J. Pharmacol. Exp. Ther. 119, 395–405.

PubMed Аннотация | Google Scholar

Дас А., Сатьяпракаш К. (2018). Антимикробные свойства натуральных продуктов: обзор.Фарма. Innovation J. 7, 532–537.

Google Scholar

Дей А. и Де Дж. Н. (2012). Растительные средства против змеиного яда, используемые этническими группами района Пурулия, Западная Бенгалия, Индия. J. Herbs Spices Med. Растения 18, 152–165. DOI: 10.1080 / 10496475.2011.652298

CrossRef Полный текст | Google Scholar

Фер М., Фроммер В. Б. и Лалонд С. (2002). Визуализация поглощения мальтозы в живых дрожжевых клетках с помощью флуоресцентных нанонаносенсоров. Proc. Natl. Акад. Sci. США. 99, 9846–9851. DOI: 10.1073 / pnas.142089199

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фер М., Лалонд С., Эрхардт Д. В. и Фроммер В. Б. (2004). Живое изображение гомеостаза глюкозы в ядрах клеток COS-7. J. Fluoresc. 14, 603–609. DOI: 10.1023 / B: JOFL.0000039347.94943.99

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фер, М., Лалонд, С., Лагер, И., Вольф, М.У. и Фроммер У. Б. (2003). Визуализация in vivo динамики поглощения глюкозы в цитозоле клеток COS-7 с помощью флуоресцентных нанонаносенсоров. J. Biol. Chem. 278, 19127–19133. DOI: 10.1074 / jbc.M301333200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фулзеле, Д. П., Намдео, А. Г. (2018). Экономически эффективное экспериментальное производство аймалицина с помощью суспензионных культур клеток Catharanthus roseus в 100-литровом биореакторе. Biotechnol. Дж. 21, 1–15. DOI: 10.9734 / BJI / 2018/43510

CrossRef Полный текст | Google Scholar

Held, P. (2005). Введение в технологию флуоресцентного резонансного переноса энергии (FRET) и ее применение в биологических науках. Winooski, VT: Примечание по применению Bio-Tek.

Google Scholar

Ху, Х., Гу, Й., Сюй, Л., Цзоу, Ю., Ван, А., Тао, Р. и др. (2017). Генетически закодированный набор инструментов для отслеживания динамики гистидина живых клеток в пространстве и времени. Sci.Отчет 7: 43479. DOI: 10.1038 / srep43479

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маллик, С. Р., Йена, Р. К., и Самал, К. С. (2012). Быстрое размножение in vitro исчезающего лекарственного растения сарпганда ( Rauwolfia serpentina ). Am. J. Plant Sci. 3, 437–442. DOI: 10.4236 / ajps.2012.34053

CrossRef Полный текст | Google Scholar

Мисра, Н., Кумар, С., и Лутра, Р. (2006). Биоконверсия аджмалицина в серпентин в корнях Catharanthus roseus.Дж. Плант. Sci. 1, 340–347. DOI: 10.3923 / jps.2006.340.347

CrossRef Полный текст | Google Scholar

Мохсин, М., Диван, Х., Хан, И., и Ахмад, А. (2015). Генетически кодируемый нанонаносенсор на основе FRET для мониторинга концентрации цинка в физиологической среде живой клетки in vivo. Biochem. Англ. J. 102, 62–68. DOI: 10.1016 / j.bej.2015.03.012

CrossRef Полный текст | Google Scholar

Морено, П. Р., ван дер Хейден, Р., и Verpoorte, R. (1995). Клеточные и тканевые культуры Catharanthus roseus : обзор литературы. Завод. Клетка. Тисс. Орг. 42, 1–25. DOI: 10.1007 / BF00037677

CrossRef Полный текст | Google Scholar

Мурашиге Т. и Скуг Ф. (1962). Обновленная среда для быстрого роста и биологических анализов с культурой ткани табака. Physiol. Plantarum. 15, 473–497. DOI: 10.1111 / j.1399-3054.1962.tb08052.x

CrossRef Полный текст | Google Scholar

Окумото, С., Лугер, Л. Л., Мичева, К. Д., Реймер, Р. Дж., Смит, С. Дж., И Фроммер, В. Б. (2005). Обнаружение высвобождения глутамата из нейронов с помощью генетически закодированных нанонананосенсоров FRET с отображением на поверхности. Proc. Natl. Акад. Sci. США. 102, 8740–8745. DOI: 10.1073 / pnas.0503274102

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шлатманн, Дж. Э., Нуутила, А. М., Ван Гулик, В. М., Тен Хупен, Х. Дж., Верпоорте, Р. и Дж. Хейнен, Дж. (1993). Масштабирование производства аджмалицина культурами растительных клеток Catharanthus roseus . Biotechnol. Bioeng. 41, 253–262 DOI: 10.1002 / бит. 260410212

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ставринидес, А., Тацис, Э. К., Капути, Л., Фуро, Э., Стивенсон, К. Э., Лоусон, и др. (2016). Структурное исследование синтеза гетероохимбиновых алкалоидов выявило элементы активного центра, которые контролируют стереоселективность. Nat. Commun. 7: 12116. DOI: 10.1038 / ncomms12116

PubMed Аннотация | CrossRef Полный текст | Google Scholar

тен Хупен, H.J., van Gulik, W.M., Schlatmann, J.E., Moreno, P.R., Vinke, J.L., Heijnen, et al. (1994). Производство аджмалицина культурами клеток Catharanthus roseus : от встряхиваемой колбы до биореактора. Завод. Клетка. Тисс. Орг. 38, 85–91. DOI: 10.1007 / BF00033865

CrossRef Полный текст | Google Scholar

Уся Т., Ватабе Т., Кадота С. и Тезука Ю. (2005). Компоненты, ингибирующие цитохром P450 2D6 (CYP2D6) Catharanthus roseus . Biol.Pharm. Бык. 28, 1021–1024. DOI: 10.1248 / bpb.28.1021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван, А., Стаут, К. Д., Чжан, К., и Джонсон, Э. Ф. (2015). Вклад ионных взаимодействий и динамики белка в связывание субстрата и ингибитора цитохрома P450 2D6 (CYP2D6). J. Biol. Chem. 290, 5092–5104. DOI: 10.1074 / jbc.M114.627661

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Зафар, Н., Муджиб, А., Али, М., Тонк, Д., Гульзар, Б., Малик, М. и др. (2019). Анализ размера генома выращенного в полевых условиях и регенерированной культуры ткани Rauvolfia serpentina (L) с помощью проточной цитометрии: гистология и сканирующее электронно-микроскопическое исследование для морфогенеза in vitro . Ind. Crop. Prod. 128, 545–555. DOI: 10.1016 / j.indcrop.2018.11.049

CrossRef Полный текст | Google Scholar

Чжэн З. и Ву М. (2004). Обработка кадмием увеличивает выработку вторичных метаболитов алкалоидов в Catharanthus roseus . Plant Sci. 166, 507–514. DOI: 10.1016 / j.plantsci.2003.10.022

CrossRef Полный текст | Google Scholar

Аптамеры и FRET-биосенсоры на основе наноматериалов: обзор последних достижений (2014–2019)

  • 1.

    Qiu X, Hildebrandt N (2015) Быстрый и мультиплексный диагностический анализ микроРНК с использованием квантовых точек переноса энергии резонанса Ферстера. ACS Nano 9: 8449–8457. https://doi.org/10.1021/acsnano.5b03364

    CAS Статья PubMed Google Scholar

  • 2.

    He L, Lu D-Q, Liang H et al (2017) Нанопинцет-тетраэдр ДНК на основе флуоресцентного резонанса с переносом энергии для высоконадежного обнаружения мРНК, связанной с опухолями, в живых клетках. ACS Nano 11: 4060–4066. https://doi.org/10.1021/acsnano.7b00725

    CAS Статья PubMed PubMed Central Google Scholar

  • 3.

    Мединц И., Хильдебрандт Н. (2014) FRET — Фёрстеровский резонансный перенос энергии. Wiley-VCH Verlag GmbH & Co, KGaA, Weinheim

    Google Scholar

  • 4.

    Клегг Р.М. (1992) [18] Флуоресцентный резонансный перенос энергии и нуклеиновые кислоты. В кн .: Методы энзимологии. Academic Press, pp. 353–388

  • 5.

    Rowland CE, Brown CW, Medintz IL, Delehanty JB (2015) Внутриклеточные зонды на основе FRET: обзор. Методы Appl Fluoresc 3: 042006. https://doi.org/10.1088/2050-6120/3/4/042006

    CAS Статья PubMed Google Scholar

  • 6.

    Хуссейн С.А. (2012) Введение в флуоресцентный резонансный перенос энергии (FRET).В: arXiv.org. https://arxiv.org/abs/0908.1815

  • 7.

    Густ А., Зандер А., Гитл А. и др. (2014) Отправная точка для измерений одиночных молекул на основе флуоресценции в биомолекулярных исследованиях. Molecules 19: 15824–15865. https://doi.org/10.3390/molecules1824

    CAS Статья PubMed PubMed Central Google Scholar

  • 8.

    Wen Y, Xing F, He S et al (2010) Флуоресцентный нанозонд на основе графена для обнаружения ионов серебра (i) с использованием оксида графена и серебряного олигонуклеотида.Chem Commun 46: 2596. https://doi.org/10.1039/b924832c

    CAS Статья Google Scholar

  • 9.

    Курт Х., Альпаслан Э., Йилдиз Б. и др. (2017) Конформационно-опосредованный резонансный перенос энергии Фёрстера (FRET) в излучающих синий поливинилпирролидон (PVP) -пассивированных наночастицах оксида цинка (ZnO). J Colloid Interface Sci 488: 348–355. https://doi.org/10.1016/j.jcis.2016.11.017

    CAS Статья PubMed Google Scholar

  • 10.

    Das P, Sedighi A, Krull UJ (2018) Определение биомаркера рака путем резонансной передачи энергии с использованием функциональных флуоресцентных нанозондов. Анальный Чим Acta 1041: 1–24. https://doi.org/10.1016/j.aca.2018.07.060

    CAS Статья PubMed Google Scholar

  • 11.

    Амири С., Ахмади Р., Салими А. и др. (2018) Сверхчувствительный и высокоселективный аптасенсор FRET для измерения Hg 2+ в образцах рыб с использованием углеродных точек / AuNP в качестве донорной / акцепторной платформы.Новый J Chem 42: 16027–16035. https://doi.org/10.1039/C8NJ02781A

    CAS Статья Google Scholar

  • 12.

    Кумар YVVA, R RM, A. J et al (2018) Разработка флуоресцентного аптасенсора на основе FRET для обнаружения афлатоксина B1 в загрязненных образцах пищевого зерна. RSC Adv 8: 10465–10473. https://doi.org/10.1039/C8RA00317C

    Артикул Google Scholar

  • 13.

    Hildebrandt N, Spillmann CM, Algar WR et al (2017) Передача энергии с помощью полупроводниковых биоконъюгатов с квантовыми точками: универсальная платформа для биосенсоров, сбора энергии и других развивающихся приложений. Chem Rev.117: 536–711. https://doi.org/10.1021/acs.chemrev.6b00030

    CAS Статья PubMed Google Scholar

  • 14.

    Li Z, He M, Xu D, Liu Z (2014) Системы и сенсоры акцепторов энергии на основе графеновых материалов.J Photochem Photobiol C Photochem Rev. 18: 1–17. https://doi.org/10.1016/j.jphotochemrev.2013.10.002

    CAS Статья Google Scholar

  • 15.

    Гейсслер Д., Линден С., Лирманн К. и др. (2014) Лантаноиды и квантовые точки как агенты передачи энергии резонанса Фёрстера для диагностики и визуализации клеток. Inorg Chem 53: 1824–1838. https://doi.org/10.1021/ic4017883

    CAS Статья PubMed Google Scholar

  • 16.

    Zu F, Yan F, Bai Z et al (2017) Тушение флуоресценции углеродных точек: обзор механизмов и приложений. Microchim. Acta 184: 1899–1914

    CAS Статья Google Scholar

  • 17.

    Хан И.М., Чжао С., Ниази С. и др. (2018) Аптасенсор FRET на основе нанокластеров серебра для чувствительного и селективного флуоресцентного обнаружения токсина Т-2. Датчики Актуаторы B Chem 277: 328–335. https://doi.org/10.1016/j.snb.2018.09.021

    CAS Статья Google Scholar

  • 18.

    Marx V (2017) Зонды: проектирование и оптимизация датчика FRET. Нат Методы 14: 949–953. https://doi.org/10.1038/nmeth.4434

    CAS Статья PubMed Google Scholar

  • 19.

    Арруэбо М., Валладарес М., Гонсалес-Фернандес Б. (2009) Наночастицы, конъюгированные с антителами, для биомедицинских приложений. J Nanomater 2009: 1-24. https://doi.org/10.1155/2009/439389

    CAS Статья Google Scholar

  • 20.

    Yüce M, Ullah N, Budak H (2015) Тенденции в методах и применениях выбора аптамеров. Аналитик 140: 5379–5399. https://doi.org/10.1039/C5AN00954E

    CAS Статья PubMed Google Scholar

  • 21.

    Юсе М., Курт Х (2017) Как сделать нанобиосенсоры: модификация поверхности и характеристика наноматериалов для приложений биосенсоров. RSC Adv 7: 49386–49403. https://doi.org/10.1039/C7RA10479K

    Артикул Google Scholar

  • 22.

    Mallikaratchy P (2017) Эволюция комплексной мишени SELEX для идентификации аптамеров против антигенов клеточной поверхности млекопитающих. Молекулы 22: 215. https://doi.org/10.3390/molecules22020215

    CAS Статья PubMed Central Google Scholar

  • 23.

    Sun N, Ding Y, Tao Z et al (2018) Разработка ДНК-зонда с апконверсией флуоресценции для обнаружения ацетамиприда путем разделения магнитных наночастиц.Food Chem 257: 289–294. https://doi.org/10.1016/j.foodchem.2018.02.148

    CAS Статья PubMed Google Scholar

  • 24.

    Srinivasan S, Ranganathan V, DeRosa MC, Murari BM (2018) Аптасенсоры без меток, основанные на флуоресцентных скрининговых анализах для обнаружения Salmonella typhimurium. Анальная биохимия 559: 17–23. https://doi.org/10.1016/j.ab.2018.08.002

    CAS Статья PubMed Google Scholar

  • 25.

    Yüce M, Kurt H, Hussain B, Budak H (2018) Систематическая эволюция лигандов путем экспоненциального обогащения для выбора аптамера. В: Sarmento B, Das NJ (eds) Biomedical Applications of Functionalized Nanomaterials, 1st edn. Elsevier, pp. 211–243

  • 26.

    Курт Х., Юсе М., Хусейн Б., Будак Х. (2016) Аптасенсор наночастиц и квантовых точек с повышающим преобразованием двойного возбуждения и квантовых точек для множественного обнаружения пищевых патогенов. Biosens Bioelectron 81: 280–286. https://doi.org/10.1016/j.bios.2016.03.005

    CAS Статья PubMed Google Scholar

  • 27.

    Yüce M, Kurt H, Hussain B et al (2018) Использование стоксовых и антистоксовых профилей излучения люминесцентных нанозондов, функционализированных аптамером, для приложений мультиплексного зондирования. ChemistrySelect 3: 5814–5823. https://doi.org/10.1002/slct.201801008

    CAS Статья Google Scholar

  • 28.

    Woo H-M, Lee J-M, Yim S, Jeong Y-J (2015) Выделение аптамеров одноцепочечной ДНК, которые отличают подтип h2 гемагглютинина вируса гриппа от H5.PLoS One 10: e0125060. https://doi.org/10.1371/journal.pone.0125060

    CAS Статья PubMed PubMed Central Google Scholar

  • 29.

    Ким М., Ум Х. Дж., Банг С. и др. (2009) Удаление мышьяка из подземных вод Вьетнама с использованием связывающего мышьяк ДНК-аптамера. Environ Sci Technol 43: 9335–9340. https://doi.org/10.1021/es7g

    CAS Статья PubMed Google Scholar

  • 30.

    Savory N, Lednor D, Tsukakoshi K et al (2013) In silico созревание специфичности связывания ДНК-аптамеров против Proteus mirabilis . Biotechnol Bioeng 110: 2573–2580. https://doi.org/10.1002/bit.24922

    CAS Статья PubMed Google Scholar

  • 31.

    Li Z, Uzawa T., Tanaka T. et al (2013) Выбор in vitro пептидных аптамеров со сродством к одностенным углеродным нанотрубкам с использованием рибосомного дисплея.Biotechnol Lett. 35: 39–45. https://doi.org/10.1007/s10529-012-1049-6

    CAS Статья PubMed Google Scholar

  • 32.

    Лим Ю.К., Кузани А.З., Дуан В. (2009) Аспекты проектирования датчиков Aptasensors. В: Коммуникации в компьютерных и информационных науках, стр. 118–127

    . Google Scholar

  • 33.

    Chandra P, Noh H-B, Won M-S, Shim Y-B (2011) Обнаружение дауномицина с использованием фосфатидилсерина и аптамера, совместно иммобилизованных на наночастицах Au, нанесенных на проводящий полимер.Biosens Bioelectron 26: 4442–4449. https://doi.org/10.1016/j.bios.2011.04.060

    CAS Статья PubMed Google Scholar

  • 34.

    Чжао В., Чиуман В., Брук М.А., Ли И. (2007) Простые и быстрые колориметрические биосенсоры на основе ДНК-аптамера и не образующей поперечных связей агрегации наночастиц золота. ChemBioChem 8: 727–731. https://doi.org/10.1002/cbic.200700014

    CAS Статья PubMed Google Scholar

  • 35.

    Yang CJ, Jockusch S, Vicens M et al (2005) Эксимерные зонды с переключением света для быстрого мониторинга белков в сложных биологических жидкостях. Proc Natl Acad Sci 102: 17278–17283. https://doi.org/10.1073/pnas.0508821102

    CAS Статья PubMed Google Scholar

  • 36.

    Khati M (2010) Будущее аптамеров в медицине. Дж. Клин Патол 63: 480–487. https://doi.org/10.1136/jcp.2008.062786

    CAS Статья PubMed Google Scholar

  • 37.

    Донг Х, Гао В., Ян Ф и др. (2010) Передача энергии резонанса флуоресценции между квантовыми точками и оксидом графена для восприятия биомолекул. Anal Chem 82: 5511–5517. https://doi.org/10.1021/ac100852z

    CAS Статья PubMed Google Scholar

  • 38.

    Дарбанди А., Датта Д., Патель К. и др. (2017) Молекулярный маяк, закрепленный на подложке из оксида графена. Нанотехнологии 28: 375501. https://doi.org/10.1088 / 1361-6528 / aa7e50

    CAS Статья PubMed Google Scholar

  • 39.

    Ghosh S, Datta D, Cheema M et al (2017) Оптическое определение гликированного альбумина на основе аптасенсора для диагностики сахарного диабета. Нанотехнологии 28: 435505. https://doi.org/10.1088/1361-6528/aa893a

    CAS Статья PubMed Google Scholar

  • 40.

    Li S, Xu L, Ma W et al (2016) Двухрежимная сверхчувствительная количественная оценка микроРНК в живых клетках с помощью хироплазмонных нанопирамид, самоорганизующихся из золота и наночастиц с повышенным преобразованием. J Am Chem Soc 138: 306–312. https://doi.org/10.1021/jacs.5b10309

    CAS Статья PubMed Google Scholar

  • 41.

    Li M, Zhou X, Guo S, Wu N (2013) Обнаружение свинца (II) с помощью «включаемого» флуоресцентного биосенсора, основанного на передаче энергии от квантовых точек CdSe / ZnS на оксид графена.Biosens Bioelectron 43: 69–74. https://doi.org/10.1016/j.bios.2012.11.039

    CAS Статья PubMed Google Scholar

  • 42.

    Джин Б., Ван С., Лин М. и др. (2017) Аптасенсор FRET на основе наночастиц с повышающим преобразованием для быстрого и сверхчувствительного обнаружения бактерий. Biosens Bioelectron 90: 525–533. https://doi.org/10.1016/j.bios.2016.10.029

    CAS Статья PubMed Google Scholar

  • 43.

    Yang W, Zhang G, Weng W et al (2014) Сигнал флуоресцентного биосенсора для MMP-2 на основе FRET между точками полупроводникового полимера и металлоорганическим каркасом. RSC Adv 4: 58852–58857. https://doi.org/10.1039/C4RA12478B

    CAS Статья Google Scholar

  • 44.

    Ван И, Бао Л., Лю З., Панг Д. В. (2011) Аптамерный биосенсор на основе передачи энергии резонанса флуоресценции от повышающего преобразования фосфора к углеродным наночастицам для обнаружения тромбина в плазме человека.Anal Chem 83: 8130-8137. https://doi.org/10.1021/ac201631b

    CAS Статья PubMed Google Scholar

  • 45.

    Li X-HH, Sun W-MM, Wu J et al (2018) Сверхчувствительный флуоресцентный аптасенсор для обнаружения карцино-эмбрионального антигена, основанный на передаче резонансной энергии флуоресценции от люминофоров с повышающим преобразованием к наночастицам Au. Анальные методы 10: 1552–1559. https://doi.org/10.1039/C7AY02803B

    CAS Статья Google Scholar

  • 46.

    Ueno Y, Furukawa K, Tin A, Hibino H (2015) Встроенный FRET-аптасенсор оксида графена: количественная оценка повышенной чувствительности аптамером с двухцепочечным спейсером ДНК. Anal Sci 31: 875–879. https://doi.org/10.2116/analsci.31.875

    CAS Статья PubMed Google Scholar

  • 47.

    Jiang H, Ling K, Tao X, Zhang Q (2015) Обнаружение теофиллина в сыворотке с помощью самособирающегося датчика наночастиц золота на основе аптамеров РНК.Biosens Bioelectron 70: 299–303. https://doi.org/10.1016/j.bios.2015.03.054

    CAS Статья PubMed Google Scholar

  • 48.

    Ким Б., Малиутов Д.М., Варшней К.Р., Веллер А. (2017) Труды семинара ICML 2017 года по интерпретируемости человеком в машинном обучении (WHI 2017). Новый J Chem 37: 3998. https://doi.org/10.1039/c3nj00594a

  • 49.

    Ахар MJ (2017) Обзор конъюгированных с аптамером наносистем квантовых точек для визуализации рака и тераностики.J Nanomedicine Res 5. https://doi.org/10.15406/jnmr.2017.05.00117

  • 50.

    Michalet X (2005) Квантовые точки для живых клеток, визуализация in vivo и диагностика. Наука (80-) 307: 538–544. https://doi.org/10.1126/science.1104274

    CAS Статья Google Scholar

  • 51.

    Zeng Z, Garoufalis CS, Terzis AF, Baskoutas S (2013) Линейные и нелинейные оптические свойства квантовых точек ядра ZnO / ZnS и ZnS / ZnO: влияние толщины оболочки, примесей и диэлектрической среды.J. Appl Phys 114: 023510. https://doi.org/10.1063/1.4813094

    CAS Статья Google Scholar

  • 52.

    Васудеван Д., Гаддам Р. Р., Тринчи А., Коул I (2015) Квантовые точки ядро ​​– оболочка: свойства и приложения. Дж. Сплавы. Compd 636: 395–404. https://doi.org/10.1016/j.jallcom.2015.02.102

    CAS Статья Google Scholar

  • 53.

    Fang B-Y, Wang C-Y, Li C et al (2017) Амплифицировано с использованием ДНКазы I и аптамера / оксида графена для определения специфического антигена простаты в сыворотке крови человека. Датчики Актуаторы B Chem 244: 928–933. https://doi.org/10.1016/j.snb.2017.01.045

    CAS Статья Google Scholar

  • 54.

    Medintz IL, Uyeda HT, Goldman ER, Mattoussi H (2005) Биоконъюгаты квантовых точек для визуализации, маркировки и зондирования. Nat Mater 4: 435–446.https://doi.org/10.1038/nmat1390

    CAS Статья PubMed Google Scholar

  • 55.

    Zhang C, Ding C, Zhou G et al (2017) Одностадийный синтез функционализированных ДНК квантовых точек без кадмия и его применение для определения белков на основе FRET. Анальный Чим Acta 957: 63–69. https://doi.org/10.1016/j.aca.2016.12.024

    CAS Статья PubMed Google Scholar

  • 56.

    Арванд М., Миррошандель А.А. (2017) Высокочувствительный аптасенсор на основе флуоресцентного резонансного переноса энергии между квантовыми точками ZnS, закрытыми l-цистеином, и листами оксида графена для определения фунгицида эдифенфоса. Biosens Bioelectron 96: 324–331. https://doi.org/10.1016/j.bios.2017.05.028

    CAS Статья PubMed Google Scholar

  • 57.

    Дуан Н., Ву С., Дай С. и др. (2015) Одновременное обнаружение патогенных бактерий с помощью биосенсора на основе аптамера и двойной резонансный перенос энергии флуоресценции от квантовых точек на углеродные наночастицы.Microchim Acta 182: 917–923. https://doi.org/10.1007/s00604-014-1406-3

    CAS Статья Google Scholar

  • 58.

    Das P, Krull UJ (2017) Обнаружение белка биомаркера рака на модифицированной целлюлозной бумаге флуоресценцией с использованием квантовых точек, связанных аптамером. Аналитик 142: 3132–3135. https://doi.org/10.1039/c7an00624a

    CAS Статья PubMed Google Scholar

  • 59.

    Sabet FS, Hosseini M, Khabbaz H et al (2017) Аптамерный биосенсор на основе FRET для селективного и чувствительного обнаружения афлатоксина B1 в арахисе и рисе. Food Chem 220: 527–532. https://doi.org/10.1016/j.foodchem.2016.10.004

    CAS Статья PubMed Google Scholar

  • 60.

    Хильдебрандт Н., Шарбоньер Л.Дж., Бек М. и др. (2005) Квантовые точки как эффективные акцепторы энергии во времяразрешающем флюороиммуноанализе.Angew Chemie Int Ed. 44: 7612–7615. https://doi.org/10.1002/anie.200501552

    CAS Статья Google Scholar

  • 61.

    So M-K, Xu C, Loening AM et al (2006) Самосветящиеся конъюгаты квантовых точек для визуализации in vivo. Nat Biotechnol 24: 339–343. https://doi.org/10.1038/nbt1188

    CAS Статья PubMed Google Scholar

  • 62.

    Doughan S, Uddayasankar U, Krull UJ (2015) Анализ гибридизации нуклеиновых кислот с резонансным переносом энергии на бумаге с использованием наночастиц с повышением конверсии в качестве доноров и квантовых точек в качестве акцепторов. Анальный Чим Acta 878: 1–8. https://doi.org/10.1016/j.aca.2015.04.036

    CAS Статья PubMed Google Scholar

  • 63.

    Qiu X, Guo J, Jin Z et al (2017) Мультиплексные анализы гибридизации нуклеиновых кислот с использованием настройки расстояния одной пары FRET.Маленький 13: 1700332. https://doi.org/10.1002/smll.201700332

    CAS Статья Google Scholar

  • 64.

    Qiu X, Guo J, Xu J, Hildebrandt N (2018) Трехмерное мультиплексирование FRET для количественной оценки ДНК с предельными значениями аттомолярного обнаружения. J. Phys Chem Lett. 9: 4379–4384. https://doi.org/10.1021/acs.jpclett.8b01944

    CAS Статья PubMed Google Scholar

  • 65.

    Qiu X, Xu J, Guo J et al (2018) Расширенная диагностика рака на основе микроРНК с использованием усиленного FRET с временной синхронизацией. Chem Sci 9: 8046–8055. https://doi.org/10.1039/C8SC03121E

    CAS Статья PubMed PubMed Central Google Scholar

  • 66.

    Guo J, Qiu X, Mingoes C et al (2019) Конформационные детали квантовой точечной ДНК, разрешенные с помощью нанорулера Förster Resonance Energy Transfer Lifetime Nanoruler. ACS Nano 13: 505–514.https://doi.org/10.1021/acsnano.8b07137

    CAS Статья PubMed Google Scholar

  • 67.

    Дуган С., Хан Й., Уддаясанкар У., Крулл У. Дж. (2014) Твердофазная ковалентная иммобилизация преобразующих наночастиц с повышением частоты для биочувствительности путем резонансной передачи энергии люминесценции. Интерфейсы приложения ACS Mater 6: 14061–14068. https://doi.org/10.1021/am503391m

  • 68.

    Li Y, Xu J, Wang L et al (2016) Флуоресцентное обнаружение бисфенола A на основе аптамеров с использованием неконъюгированных наночастиц золота и квантовых точек CdTe.Датчики-приводы, B Chem 222: 815–822. https://doi.org/10.1016/j.snb.2015.08.130

    Артикул Google Scholar

  • 69.

    Tianyu H, Xu Y, Weidan N, Xingguang S (2016) Анализ агрегации ртути (II) на основе аптамеров с использованием наночастиц золота и флуоресцентных квантовых точек CdTe. Microchim Acta 183: 2131–2137. https://doi.org/10.1007/s00604-016-1831-6

    CAS Статья Google Scholar

  • 70.

    Lu X, Wang C, Qian J et al (2019) Управляемый мишенью включающий флуоресцентный аптасенсор для определения следов афлатоксина B1 на основе высоко флуоресцентных тройных квантовых точек CdZnTe. Анальный Чим Acta 1047: 163–171. https://doi.org/10.1016/j.aca.2018.10.002

    CAS Статья PubMed Google Scholar

  • 71.

    Kavosi B, Navaee A, Salimi A (2018) Усиленное определение передачи энергии резонанса флуоресценции простатического специфического антигена на основе агрегации квантовых точек CdTe / антитела и аптамера, декорированного дендримером AuNPs-PAMAM.Дж. Люмин 204: 368–374. https://doi.org/10.1016/j.jlumin.2018.08.012

    CAS Статья Google Scholar

  • 72.

    Lu Z, Chen X, Hu W (2017) Аптасенсор флуоресценции на основе полупроводниковых квантовых точек и нанолистов MoS2 для обнаружения охратоксина А. Датчики Актуаторы B Chem 246: 61–67. https://doi.org/10.1016/j.snb.2017.02.062

    CAS Статья Google Scholar

  • 73.

    Qiu Z, Shu J, He Y et al (2017) Флуоресцентный аптасенсор на основе квантовых точек CdTe / CdSe с гемин / G-квадруплексным ДНКзимом для чувствительного обнаружения лизоцима с использованием амплификации по катящемуся кругу и гибридизации цепей. Биосенс ​​Биоэлектрон 87: 18–24. https://doi.org/10.1016/j.bios.2016.08.003

    CAS Статья PubMed Google Scholar

  • 74.

    Lu Z, Chen X, Wang Y et al (2015) Анализ восстановления флуоресценции афлатоксина B1 на основе аптамера с использованием системы гашения, состоящей из квантовых точек и оксида графена.Microchim Acta 182: 571–578. https://doi.org/10.1007/s00604-014-1360-0

    CAS Статья Google Scholar

  • 75.

    Xiang L, Tang J (2017) QD-аптамер в качестве донора для хемосенсора на основе FRET и оценка сродства между ацетамипридом и его аптамером. RSC Adv 7: 8332–8337. https://doi.org/10.1039/c6ra26118c

    CAS Статья Google Scholar

  • 76.

    Li Y, Su R, Xu J et al (2018) Стратегия зондирования на основе аптамеров для 17? -Эстрадиола посредством передачи энергии резонанса флуоресценции между противоположно заряженными квантовыми точками CdTe и наночастицами золота. J Nanosci Nanotechnol 18: 1517–1527. https://doi.org/10.1166/jnn.2018.14235

    CAS Статья PubMed Google Scholar

  • 77.

    Hu W, Chen Q, Li H et al (2016) Изготовление нового безметочного аптасенсора для ацетамиприда путем резонансного переноса энергии флуоресценции между NH 2 -NaYF 4: Yb, Ho @ SiO 2 и наночастицами Au.Biosens Bioelectron 80: 398–404. https://doi.org/10.1016/j.bios.2016.02.001

    CAS Статья PubMed Google Scholar

  • 78.

    Tu L, Liu X, Wu F, Zhang H (2015) Динамика миграции энергии возбуждения в наноматериалах с повышающим преобразованием. Chem Soc Rev. 44: 1331–1345. https://doi.org/10.1039/c4cs00168k

    CAS Статья PubMed Google Scholar

  • 79.

    Zhou B, Shi B, Jin D, Liu X (2015) Управление повышающим преобразованием нанокристаллов для новых приложений. Nat. Nanotechnol. 10: 924–936

    CAS Статья Google Scholar

  • 80.

    Chen H, Guan Y, Wang S et al (2014) Обнаружение включения маркера рака на основе передачи энергии люминесценции в ближнем инфракрасном диапазоне от NaYF 4 : Yb, Tm / NaGdF 4 Core –Оболочечное преобразование наночастиц в золотые наностержни. Langmuir 30: 13085–13091.https://doi.org/10.1021/la502753e

    CAS Статья PubMed Google Scholar

  • 81.

    Li C, Zuo J, Li Q et al (2017) Одностадийный иммуноанализ цельной крови in situ на основе твердых субстратов, основанный на FRET между апконверсией и наночастицами золота. Biosens Bioelectron 92: 335–341. https://doi.org/10.1016/j.bios.2016.11.003

    CAS Статья PubMed Google Scholar

  • 82.

    Чен Х, Юань Ф, Ван С. и др. (2013) Определение тромбина в красной области на основе аптамеров посредством резонансной передачи энергии флуоресценции между наночастицами NaYF4: Yb, Er с повышающим преобразованием и золотыми наностержнями. Биосенс ​​Биоэлектрон 48: 19–25. https://doi.org/10.1016/j.bios.2013.03.083

    CAS Статья PubMed Google Scholar

  • 83.

    Hwang S-H, Im S-G, Sung H et al (2014) Резонансный перенос энергии Ферстера на основе наночастиц с повышающим преобразованием для обнаружения последовательности IS6110 комплекса Mycobacterium tuberculosis в мокроте.Biosens Bioelectron 53: 112–116. https://doi.org/10.1016/j.bios.2013.09.011

    CAS Статья PubMed Google Scholar

  • 84.

    Вилела П., Эль-Сагир А., Миллар TM и др. (2017) Оптические сенсоры на основе наночастиц с повышающим преобразованием оксида графена для целевого обнаружения биомаркеров мРНК, присутствующих при болезни Альцгеймера и раке простаты. Датчики ACS 2: 52–56. https://doi.org/10.1021/acssensors.6b00651

    CAS Статья PubMed Google Scholar

  • 85.

    Ye WW, Tsang M-K, Liu X et al (2014) Биосенсор на основе передачи энергии резонанса люминесценции с повышающим преобразованием (LRET) для быстрого и сверхчувствительного обнаружения вируса птичьего гриппа подтипа H7. Small 10: 2390–2397. https://doi.org/10.1002/smll.201303766

    CAS Статья PubMed Google Scholar

  • 86.

    Long Q, Li H, Zhang Y, Yao S (2015) Анализ флуоресцентного резонансного переноса энергии на основе наночастиц с повышающим преобразованием для фосфорорганических пестицидов.Biosens Bioelectron 68: 168–174. https://doi.org/10.1016/j.bios.2014.12.046

    CAS Статья PubMed Google Scholar

  • 87.

    Li H, Sun D, ​​Liu Y, Liu Z (2014) Сверхчувствительный гомогенный аптасенсор для канамицина, основанный на передаче резонансной энергии флуоресценции с повышением частоты преобразования. Biosens Bioelectron 55: 149–156. https://doi.org/10.1016/j.bios.2013.11.079

    CAS Статья PubMed Google Scholar

  • 88.

    Cheng K, Zhang J, Zhang L et al (2017) Аптамерный биосенсор для обнаружения Salmonella typhimurium, основанный на передаче энергии люминесценции от легированного Mn 2+ NaYF 4: Yb, Tm, преобразующего наночастицы в золотые наностержни. Spectrochim Acta Часть A Mol Biomol Spectrosc 171: 168–173. https://doi.org/10.1016/j.saa.2016.08.012

    CAS Статья Google Scholar

  • 89.

    Hao T, Wu X, Xu L et al (2017) Сверхчувствительное обнаружение простатоспецифического антигена и тромбина на основе пирамид, собранных из наночастиц с повышенным преобразованием золота.Маленький 13: 1603944. https://doi.org/10.1002/smll.201603944

    CAS Статья Google Scholar

  • 90.

    Qu A, Wu X, Xu L et al (2017) Тримеры Au – Au – UCNP с активным SERS- и люминесценцией для аттомолярного обнаружения двух биомаркеров рака. Наномасштаб 9: 3865–3872. https://doi.org/10.1039/C6NR09114H

    CAS Статья PubMed Google Scholar

  • 91.

    Zhang H, Fang C, Wu S. et al (2015) Аптасенсор на основе резонансного переноса энергии люминесценции с повышенным преобразованием частоты для чувствительного обнаружения окситетрациклина. Анальная биохимия 489: 44–49. https://doi.org/10.1016/j.ab.2015.08.011

    CAS Статья PubMed Google Scholar

  • 92.

    Liu Y, Ouyang Q, Li H et al (2018) Датчик флуоресценции включения Hg 2+ в пищевых продуктах на основе FRET между аптамерными наночастицами с повышающей конверсией и наночастицами золота.J. Agric Food Chem. 66: 6188–6195. https://doi.org/10.1021/acs.jafc.8b00546

    CAS Статья PubMed Google Scholar

  • 93.

    Wang Y, Wei Z, Luo X et al (2019) Сверхчувствительный гомогенный аптасенсор для карциноэмбрионального антигена, основанный на передаче резонансной энергии флуоресценции с повышением конверсии. Таланта 195: 33–39. https://doi.org/10.1016/j.talanta.2018.11.011

    CAS Статья PubMed Google Scholar

  • 94.

    Wu S, Duan N, Zhang H, Wang Z (2015) Одновременное обнаружение микроцизина-LR и окадаиновой кислоты с использованием аптасенсора с двойным флуоресцентным резонансным переносом энергии. Anal Bioanal Chem. 407: 1303–1312. https://doi.org/10.1007/s00216-014-8378-3

    CAS Статья PubMed Google Scholar

  • 95.

    Wu Z, Xu E, Jin Z, Irudayaraj J (2018) Сверхчувствительный аптасенсор, основанный на флуоресцентном резонансном переносе энергии и рециклинге мишеней с помощью экзонуклеаз для обнаружения патулина.Food Chem 249: 136–142. https://doi.org/10.1016/j.foodchem.2018.01.025

    CAS Статья PubMed Google Scholar

  • 96.

    Li H, Shi L, en SD et al (2016) Биосенсор с резонансным флуоресцентным переносом энергии между наночастицами с повышающим преобразованием и наночастицами палладия для сверхчувствительного обнаружения CEA. Biosens Bioelectron 86: 791–798. https://doi.org/10.1016/j.bios.2016.07.070

    CAS Статья PubMed Google Scholar

  • 97.

    Dai S, Wu S, Duan N, Wang Z (2016) Аптасенсор на основе резонансного переноса энергии люминесценции для микотоксина охратоксина A с использованием наночастиц повышающего преобразования и золотых наностержней. Microchim Acta 183: 1909–1916. https://doi.org/10.1007/s00604-016-1820-9

    CAS Статья Google Scholar

  • 98.

    Смит Н.М., Амран С., Розу Ф. и др. (2012) Взаимодействие ртути-тимина с архитектурой G-квадруплекса кресельного типа.Chem Commun 48: 11464. https://doi.org/10.1039/c2cc36481f

    CAS Статья Google Scholar

  • 99.

    Büning-Pfaue H (2003) Анализ воды в пищевых продуктах методом ближней инфракрасной спектроскопии. Food Chem 82: 107–115. https://doi.org/10.1016/S0308-8146(02)00583-6

    CAS Статья Google Scholar

  • 100.

    Kong L, Li Y, Ma C et al (2018) Чувствительный иммуноанализ фактора фон Виллебранда, основанный на флуоресцентном резонансном переносе энергии между квантовыми точками графена и наночастицами Ag @ Au.Коллоидные поверхности B Биоинтерфейсы 165: 286–292. https://doi.org/10.1016/j.colsurfb.2018.02.049

    CAS Статья PubMed Google Scholar

  • 101.

    Gao X, Zhang B, Zhang Q et al (2018) Влияние комбинированного режима на структуру и свойства композитов графеновых квантовых точек и порфиринов. Коллоидные поверхности B Биоинтерфейсы 172: 207–212. https://doi.org/10.1016/j.colsurfb.2018.08.010

    CAS Статья PubMed Google Scholar

  • 102.

    He Y, Wen X, Zhang B, Fan Z (2018) Новый аптасенсор для сверхчувствительного обнаружения канамицина на основе одноцепочечного ДНК-связывающего белка с квантовыми точками графеноксида. Датчики-приводы, B Chem 265: 20–26. https://doi.org/10.1016/j.snb.2018.03.029

    CAS Статья Google Scholar

  • 103.

    Шен Дж., Чжу Й., Ян Х, Ли С. (2012) Квантовые точки графена: возникающие нанолайки для биоимиджинга, сенсоров, катализа и фотоэлектрических устройств.Chem Commun 48: 3686. https://doi.org/10.1039/c2cc00110a

    CAS Статья Google Scholar

  • 104.

    Shi J, Chan C, Pang Y et al (2015) Биосенсор флуоресцентного резонансного переноса энергии (FRET) на основе квантовых точек графена (GQD) и наночастиц золота (AuNP) для обнаружения последовательности гена mecA Золотистый стафилококк. Biosens Bioelectron 67: 595–600. https://doi.org/10.1016/j.bios.2014.09.059

    CAS Статья PubMed Google Scholar

  • 105.

    Шен Дж, Чжу Й, Ян Х и др. (2012) Гидротермальный синтез графенеквантовых точек, поверхностно пассивированных полиэтиленгликолем, и их фотоэлектрическое преобразование в ближнем инфракрасном свете. New J Chem 36: 97–101. https://doi.org/10.1039/C1NJ20658C

    CAS Статья Google Scholar

  • 106.

    Shi J, Lyu J, Tian F, Yang M (2017) Биосенсор включения флуоресценции на основе графеновых квантовых точек (GQD) и нанолистов дисульфида молибдена (MoS2) для обнаружения молекул адгезии эпителиальных клеток (EpCAM). Biosens Bioelectron 93: 182–188. https://doi.org/10.1016/j.bios.2016.09.012

    CAS Статья PubMed Google Scholar

  • 107.

    Pfeiffer F, Mayer G (2016) Выбор и биосенсорное применение аптамеров для малых молекул.Front Chem 4 (25). https://doi.org/10.3389/fchem.2016.00025

  • 108.

    Pfohl-Leszkowicz A, Manderville RA (2007) Охратоксин A: Обзор токсичности и канцерогенности для животных и людей. Mol Nutr Food Res 51: 61–99. https://doi.org/10.1002/mnfr.200600137

    Артикул PubMed Google Scholar

  • 109.

    Cao L-H, Li H-Y, Xu H et al (2017) Разнообразные структурные превращения растворения-рекристаллизации и последовательное поведение резонансного переноса энергии Фёрстера люминесцентным пористым Cd-MOF.Дальт Транс 46: 11656–11663. https://doi.org/10.1039/C7DT02697H

    CAS Статья Google Scholar

  • 110.

    Tian J, Wei W, Wang J et al (2018) Аптасенсор флуоресцентного резонансного переноса энергии между наноцериями и квантовыми точками графена для определения охратоксина A. Anal Chim Acta 1000: 265–272. https://doi.org/10.1016/j.aca.2017.08.018

    CAS Статья PubMed Google Scholar

  • 111.

    Cheng X, Cen Y, Xu G et al (2018) Флуорометрическое определение АТФ на основе аптамера путем использования FRET между углеродными точками и оксидом графена. Microchim Acta 185 (144). https://doi.org/10.1007/s00604-018-2683-z

  • 112.

    Wu X, Song Y, Yan X et al (2017) Квантовые точки углерода как датчики флуоресцентного резонансного переноса энергии для определения фосфорорганических пестицидов. Biosens Bioelectron 94: 292–297. https://doi.org/10.1016/j.bios.2017.03.010

    CAS Статья PubMed Google Scholar

  • 113.

    Mohammadi S, Salimi A, Hamd-Ghadareh S et al (2018) Иммуносенсор FRET для чувствительного обнаружения онкомаркера CA 15-3 в образце сыворотки человека и клетках рака груди с использованием функционализированных антителами люминесцентных углеродных точек и аптамера AuNPs-дендример в качестве донорно-акцепторная пара. Анальная биохимия 557: 18–26. https://doi.org/10.1016/j.ab.2018.06.008

    CAS Статья PubMed Google Scholar

  • 114.

    Zhu S, Song Y, Zhao X et al (2015) Механизм фотолюминесценции в углеродных точках (графеновые квантовые точки, углеродные наноточки и полимерные точки): текущее состояние и перспективы на будущее.Nano Res 8: 355–381

    CAS Статья Google Scholar

  • 115.

    Wang X, Xu G, Wei F et al (2017) Высокочувствительный и селективный аптасенсор для обнаружения аденозина на основе резонансной передачи энергии флуоресценции от углеродных точек к нанографиту. J Colloid Interface Sci 508: 455–461. https://doi.org/10.1016/j.jcis.2017.07.028

    CAS Статья PubMed Google Scholar

  • 116.

    Zhao Q, Zhou C, Yang Q et al (2019) Флуоресцентный зонд на основе FRET для перекиси водорода, основанный на использовании квантовых точек углерода, конъюгированных с нанокластерами золота. Microchim Acta 186 (294). https://doi.org/10.1007/s00604-019-3398-5

  • 117.

    Qian ZS, Shan XY, Chai LJ et al (2015) Флуоресцентный наносенсор на основе графеновых квантовых точек — аптамерный зонд и платформа из оксида графена для обнаружения иона свинца (II). Biosens Bioelectron 68: 225–231. https: // doi.org / 10.1016 / j.bios.2014.12.057

    CAS Статья PubMed Google Scholar

  • 118.

    Saberi Z, Rezaei B, Faroukhpour H, Ensafi AA (2018) Флуорометрический аптасенсор для метамфетамина на основе флуоресцентного резонансного переноса энергии с использованием нанолистов оксигидроксида кобальта и углеродных точек. Microchim Acta 185: 303. https://doi.org/10.1007/s00604-018-2842-2

    CAS Статья Google Scholar

  • 119.

    Shen X, Xu L, Zhu W et al (2017) Включающий флуоресцентный аптасенсор на основе углеродных точек для чувствительного обнаружения аденозина. New J Chem 41: 9230–9235. https://doi.org/10.1039/C7NJ02384G

    CAS Статья Google Scholar

  • 120.

    Xu M, Gao Z, Zhou Q et al (2016) Углеродные точки, координированные с ионами тербия, для флуоресцентного аптасенсинга аденозин-5′-трифосфата с немодифицированными наночастицами золота. Biosens Bioelectron 86: 978–984.https://doi.org/10.1016/j.bios.2016.07.105

    CAS Статья PubMed Google Scholar

  • 121.

    Zhu L, Xu G, Song Q et al (2016) Высокочувствительное определение дофамина с помощью включаемого флуоресцентного биосенсора на основе углеродных точек, меченных аптамером, и нанографита. Датчики Актуаторы B Chem 231: 506–512. https://doi.org/10.1016/j.snb.2016.03.084

    CAS Статья Google Scholar

  • 122.

    Ван Б., Чен И., Ву И и др. (2016) Аптамер индуцировал сборку флуоресцентных углеродных точек, допированных азотом, на наночастицах золота для чувствительного обнаружения AFB 1. Biosens Bioelectron 78: 23–30. https://doi.org/10.1016/j.bios.2015.11.015

    CAS Статья PubMed Google Scholar

  • 123.

    Ван И, Ма Т., Ма С. и др. (2017) Флуорометрическое определение антибиотика канамицина путем индуцированного аптамером тушения FRET и восстановления между нанолистами MoS2 и углеродными точками.Microchim Acta 184: 203–210. https://doi.org/10.1007/s00604-016-2011-4

    CAS Статья Google Scholar

  • 124.

    Zhu X, Zheng H, Wei X et al (2013) Металлоорганический каркас (MOF): новая сенсорная платформа для биомолекул. Chem Commun 49: 1276. https://doi.org/10.1039/c2cc36661d

    CAS Статья Google Scholar

  • 125.

    McKinlay AC, Morris RE, Horcajada P et al (2010) BioMOFs: металл-органические основы для биологических и медицинских приложений. Angew Chemie Int Ed 49: 6260–6266. https://doi.org/10.1002/anie.201000048

    CAS Статья Google Scholar

  • 126.

    Ma D, Wang W, Li Y et al (2010) Синтез 2,5-пиразиндикарбоксилатных и оксалатных лигандов in situ, приводящий к микропористому органическому каркасу европия, способному избирательно воспринимать небольшие молекулы.CrystEngComm 12: 4372. https://doi.org/10.1039/c0ce00135j

    CAS Статья Google Scholar

  • 127.

    Qu F, Sun C, Lv X, You J (2018) Металлоорганический каркас на основе тербия и система наночастиц золота в качестве флуорометрического зонда для определения аденозинтрифосфата на основе аптамера. Микрохим Акта 185: 359. https://doi.org/10.1007/s00604-018-2888-1

    CAS Статья PubMed Google Scholar

  • 128.

    Ли Дж., Ким Дж., Ким С., Мин Д.Х. (2016) Биосенсоры на основе оксида графена и их биомедицинское применение. Adv. Препарат Делив. Ред. 105: 275–287

    CAS Статья Google Scholar

  • 129.

    Zou W, Gong F, Gu T et al (2018) Эффективная стратегия определения пирофосфата на основе богатых азотом квантовых точек в сочетании с оксидом графена. Microchem J 141: 466–472. https://doi.org/10.1016/j.microc.2018.06.004

    CAS Статья Google Scholar

  • 130.

    Dhiman A, Kalra P, Bansal V et al (2017) Диагностические платформы для точек оказания помощи на основе аптамеров. Датчики Актуаторы, B Chem. 246: 535–553

    CAS Статья Google Scholar

  • 131.

    Lee J, Samson AAS, Yim Y et al (2019) Анализ FRET для количественного определения ингибиторов экзонуклеазы EcoRV с использованием пергаментной бумаги, отпечатанной на струйной печати с оксидом графена и ДНК, меченной FAM. Microchim Acta 186 (211). https://doi.org/10.1007/s00604-019-3317-9

  • 132.

    Алонсо-Кристобаль П., Вилела П., Эль-Сагир А. и др. (2015) Высокочувствительный датчик ДНК на основе наночастиц с повышающим преобразованием и оксида графена. Интерфейсы приложения ACS Mater 7: 12422–12429. https://doi.org/10.1021/am507591u

    CAS Статья PubMed Google Scholar

  • 133.

    Фурукава К., Уэно Ю., Такамура М., Хибино Х. (2016) Graphene FRET Aptasensor. Датчики ACS 1: 710–716. https://doi.org/10.1021/acssensors.6b00191

    CAS Статья Google Scholar

  • 134.

    Tian F, Lyu J, Shi J, Yang M (2017) Анализ флуоресцентного резонансного переноса энергии (FRET) на основе графена и графеноподобных материалов двух наименований для биологических применений. Биосенс ​​Биоэлектрон 89: 123–135. https://doi.org/10.1016/j.bios.2016.06.046

    CAS Статья PubMed Google Scholar

  • 135.

    Гарсия-Каньяс В., Симо С., Эрреро М. и др. (2012) Настоящие и будущие проблемы анализа пищевых продуктов: Foodomics. Anal Chem 84: 10150-10159. https://doi.org/10.1021/ac301680q

    CAS Статья PubMed Google Scholar

  • 136.

    Арнольд С.М., Кларк К.Э., Staples CA и др. (2013) Актуальность питьевой воды как источника воздействия бисфенола на человека A. J Expo Sci Environ Epidemiol 23: 137–144. https: // doi.org / 10.1038 / jes.2012.66

    CAS Статья PubMed Google Scholar

  • 137.

    Zhu Y, Cai Y, Xu L et al (2015) Создание FRET биосенсора аптамер / оксид графена для одноэтапного обнаружения бисфенола A. Интерфейсы ACS Appl Mater 7: 7492–7496. https://doi.org/10.1021/acsami.5b00199

    CAS Статья PubMed Google Scholar

  • 138.

    Zhang H, Zhang H, Aldalbahi A et al (2017) Флуоресцентные биосенсоры на основе графена и оксида графена. Биосенс ​​Биоэлектрон 89: 96–106. https://doi.org/10.1016/j.bios.2016.07.030

    CAS Статья PubMed Google Scholar

  • 139.

    Zhou ZM, Zhou J, Chen J et al (2014) Обнаружение карцино-эмбрионального антигена на основе флуоресцентного резонансного переноса энергии между квантовыми точками и оксидом графена.Биосенс ​​Биоэлектрон 59: 397–403. https://doi.org/10.1016/j.bios.2014.04.002

    CAS Статья PubMed Google Scholar

  • 140.

    Кенри Г.А., Чжан Х и др. (2016) Высокочувствительное и селективное флуоресцентное определение малярийного биомаркера на основе аптамеров с использованием однослойных MoS2Nanosheets. Датчики ACS 1: 1315–1321. https://doi.org/10.1021/acssensors.6b00449

    CAS Статья Google Scholar

  • 141.

    Сингх П., Гупта Р., Синха М. и др. (2016) Платформа цифрового ответа на основе MoS2 для флуоресцентного обнаружения патогенов на основе аптамера. Microchim Acta 183: 1501–1506. https://doi.org/10.1007/s00604-016-1762-2

    CAS Статья Google Scholar

  • 142.

    Yuan Y, Li R, Liu Z (2014) Создание водорастворимого слоистого нанолиста WS 2 в качестве платформы для биосенсинга. Anal Chem 86: 3610–3615. https: // doi.org / 10.1021 / ac5002096

    CAS Статья PubMed Google Scholar

  • 143.

    Zhang Y, Zheng B, Zhu C et al (2015) Наносенсоры на основе однослойных дихалькогенидов переходных металлов на основе нанолистов для быстрого, чувствительного и мультиплексного обнаружения ДНК. Adv Mater 27: 935–939. https://doi.org/10.1002/adma.201404568

    CAS Статья PubMed Google Scholar

  • 144.

    Ge J, Ou E-C, Yu R-Q, Chu X (2014) Новый аптамерный нанобиосенсор, основанный на архитектуре самособирающихся нанолистов ДНК-MoS 2 для обнаружения биомолекул. J Mater Chem B 2: 625–628. https://doi.org/10.1039/C3TB21570A

    CAS Статья PubMed Google Scholar

  • 145.

    Cui F, Ji J, Sun J et al (2019) Новый магнитно-флуоресцентный биосенсор на основе графеновых квантовых точек для быстрого, эффективного и чувствительного разделения и обнаружения циркулирующих опухолевых клеток.Anal Bioanal Chem 411: 985–995. https://doi.org/10.1007/s00216-018-1501-0

    CAS Статья PubMed Google Scholar

  • 146.

    Gao L, Li Q, Deng Z et al (2017) Высокочувствительное определение белка с помощью ковалентно связанного аптамера с MoS2 и стратегии амплификации с помощью экзонуклеаз. Int J Nanomedicine 12: 7847–7853. https://doi.org/10.2147/IJN.S145585

    CAS Статья PubMed PubMed Central Google Scholar

  • 147.

    Jia L, Ding L, Tian J et al (2015) Нанопластинки MoS 2, загруженные аптамером, в качестве нанозондов для обнаружения внутриклеточного АТФ и контролируемой фотодинамической терапии. Наномасштаб 7: 15953–15961. https://doi.org/10.1039/C5NR02224J

    CAS Статья PubMed Google Scholar

  • 148.

    Равикумар А., Паннеерсельвам П., Радхакришнан К. и др. (2018) Нанолисты MoS 2 в качестве эффективного флуоресцентного тушителя для последовательного обнаружения ионов мышьяка в водной системе.Appl Surf Sci 449: 31–38. https://doi.org/10.1016/j.apsusc.2017.12.098

    CAS Статья Google Scholar

  • 149.

    Xu S, Feng X, Gao T et al (2017) Аптамер индуцировал многоцветный биосенсор с резонансным переносом энергии флуоресценции Au NCs-MoS 2 для одновременного двухцветного обнаружения множества опухолевых маркеров с помощью возбуждения на одной длине волны. Анальный Чим Acta 983: 173–180. https://doi.org/10.1016/j.aca.2017.06.023

    CAS Статья PubMed Google Scholar

  • 150.

    Chen J, Li Y, Huang Y et al (2019) Флуорометрический анализ дофамина, основанный на системе передачи энергии, состоящей из квантовых точек MoS2, функционализированных аптамером, и нанолистов MoS2. Microchim Acta 186 (58). https://doi.org/10.1007/s00604-018-3143-5

  • 151.

    Эстебан-Фернандес де Авила Б., Лопес-Рамирес М.А., Баес Д.Ф. и др. (2016) Каталитические микродвигатели на основе графена, модифицированные аптамером: выключено – включено флуоресцентное обнаружение рицина.Датчики ACS 1: 217–221. https://doi.org/10.1021/acssensors.5b00300

    CAS Статья Google Scholar

  • 152.

    Guo H, Li J, Li Y et al (2018) Включаемый флуоресцентный датчик для обнаружения Hg 2+ на основе оксида графена и аптамеров ДНК. New J Chem 42: 11147–11152. https://doi.org/10.1039/C8NJ01709C

    CAS Статья Google Scholar

  • 153.

    Zhang J, Li Z, Zhao S, Lu Y (2016) Зависимая от размера модуляция взаимодействий оксид графена с аптамером для детектирования афлатоксина B 1 на основе усиленной флуоресценции с настраиваемым динамическим диапазоном. Аналитик 141: 4029–4034. https://doi.org/10.1039/C6AN00368K

    CAS Статья PubMed Google Scholar

  • 154.

    Qin J, Cui X, Wu P et al (2017) Анализ флуоресцентного сенсора на β-лактамазу в молоке на основе комбинации аптамера и оксида графена.Food Control 73: 726–733. https://doi.org/10.1016/j.foodcont.2016.09.023

    CAS Статья Google Scholar

  • 155.

    Ha N, Jung I-P, La I et al (2017) Сверхчувствительное обнаружение канамицина для обеспечения безопасности пищевых продуктов с использованием флуоресцентного аптасенсора на основе восстановленного оксида графена. Sci Rep 7 (40305). https://doi.org/10.1038/srep40305

  • 156.

    Weng X, Neethirajan S (2016) Микрожидкостный биосенсор, использующий оксид графена и функционализированные аптамером квантовые точки для обнаружения аллергена арахиса.Biosens Bioelectron 85: 649–656. https://doi.org/10.1016/j.bios.2016.05.072

    CAS Статья PubMed Google Scholar

  • 157.

    Sui N, Wang L, Xie F et al (2016) Сверхчувствительный анализ тромбина на основе аптамеров, основанный на усиленной металлом резонансной передаче энергии флуоресценции. Microchim Acta 183: 1563–1570. https://doi.org/10.1007/s00604-016-1774-y

    CAS Статья Google Scholar

  • 158.

    Persson BNJ, Lang ND (1982) Электронно-дырочное тушение возбужденных состояний вблизи металла. Phys Rev B 26: 5409–5415. https://doi.org/10.1103/PhysRevB.26.5409

    CAS Статья Google Scholar

  • 159.

    Chen C, Midelet C, Bhuckory S. et al (2018) Наноповерхностная передача энергии от долгоживущих доноров тербия к золотым наночастицам. J. Phys Chem. C 122: 17566–17574. https://doi.org/10.1021/acs.jpcc.8b06539

    CAS Статья Google Scholar

  • 160.

    Дженнингс Т.Л., Сингх М.П., ​​Страус Г.Ф. (2006) Флуоресцентное гашение на время жизни вблизи d = 1,5 нм Наночастицы золота: проверка достоверности NSET. J Am Chem Soc 128: 5462–5467. https://doi.org/10.1021/ja0583665

    CAS Статья PubMed Google Scholar

  • 161.

    Li G, Zeng J, Liu H et al (2019) Флуорометрический аптамерный нанозонд для альфа-фетопротеина, использующий FRET между наночастицами 5-карбоксифлуоресцеина и палладия.Microchim Acta 186 (314). https://doi.org/10.1007/s00604-019-3403-z

  • 162.

    Holzinger M, Le Goff A, Cosnier S (2014) Наноматериалы для биосенсорных приложений: обзор. Front Chem 2: 1–10. https://doi.org/10.3389/fchem.2014.00063

    CAS Статья Google Scholar

  • 163.

    Abouna GM (2004) Использование маргинальных-субоптимальных донорских органов: практическое решение проблемы нехватки органов.Энн Трансплант 9: 62–66. https://doi.org/10.1021/cm020732l

  • 164.

    Юань Ф, Чен Х, Сюй Дж и др. (2014) Передача энергии люминесценции на основе аптамеров от ближней инфракрасной области к ближней инфракрасной области, преобразовывающей наночастицы в золотые наностержни, и ее применение для обнаружения тромбина. Chem — A Eur J 20: 2888–2894. https://doi.org/10.1002/chem.201304556

    CAS Статья Google Scholar

  • 165.

    Xing H, Wei T, Lin X, Dai Z (2018) MnCuInS / ZnS @ BSA в ближнем инфракрасном диапазоне и наночастица Au, подобная ежу, в качестве новой донорно-акцепторной пары для улучшенного биосенсинга FRET. Анальный Чим Acta 1042: 71–78. https://doi.org/10.1016/j.aca.2018.05.048

    CAS Статья PubMed Google Scholar

  • 166.

    Zhang R, Sun J, Ji J et al (2019) Новый биосенсор «OFF-ON», основанный на наноповерхностном переносе энергии между золотыми нанокрестами и графеновыми квантовыми точками для внутриклеточного зондирования и отслеживания АТФ.Датчики-приводы, B Chem 282: 910–916. https://doi.org/10.1016/j.snb.2018.11.141

    CAS Статья Google Scholar

  • 167.

    Qaddare SH, Salimi A (2017) Усиленное флуоресцентное зондирование ДНК с использованием люминесцентных углеродных точек и AuNP / GO в качестве сенсорной платформы: новое сочетание FRET и гибридизации ДНК для обнаружения гомогенного гена ВИЧ-1 на фемтомолярном уровне . Biosens Bioelectron 89: 773–780. https: // doi.org / 10.1016 / j.bios.2016.10.033

    CAS Статья PubMed Google Scholar

  • 168.

    Wang Y, Gan N, Zhou Y et al (2017) Новый переключатель флуоресцентного аптамера с одноцепочечным ДНК-связывающим белком на основе FRET для гомогенного обнаружения антибиотиков. Biosens Bioelectron 87: 508–513. https://doi.org/10.1016/j.bios.2016.08.107

    CAS Статья PubMed Google Scholar

  • 169.

    Yu M, Wang H, Fu F et al (2017) Платформа на основе резонансной передачи энергии Фёрстера с двойным распознаванием для одноэтапного чувствительного обнаружения патогенных бактерий с использованием флуоресцентных нанокластеров ванкомицин-золото и наночастиц аптамер-золото. Anal Chem 89: 4085-4090. https://doi.org/10.1021/acs.analchem.6b04958

    CAS Статья PubMed Google Scholar

  • 170.

    Han Z, Chen L, Weng Q et al (2018) Структура ядра / оболочки тройных квантовых точек @ CdSeTe из золота с кремнеземным покрытием для детектирования флуоресценции и двухмодальной визуализации.Датчики Актуаторы B Chem 258: 508–516. https://doi.org/10.1016/j.snb.2017.11.157

    CAS Статья Google Scholar

  • 171.

    Ye T, Peng Y, Yuan M et al (2019) «включающий» флуорометрический анализ для обнаружения канамицина с использованием нанокластеров серебра и передачи энергии, усиленной поверхностным плазмоном. Microchim Acta 186 (40). https://doi.org/10.1007/s00604-018-3161-3

  • 172.

    Léger C, Di Meo T, Aumont-Nicaise M et al (2019) Индуцированный лигандом конформационный переключатель в искусственном каркасе бидоменного белка. Sci Rep 9 (1178). https://doi.org/10.1038/s41598-018-37256-5

  • 173.

    Wu Y-T, Qiu X, Lindbo S. et al (2018) Иммуноанализ FRET на основе квантовых точек на HER2 с использованием сверхмалых аффинных белков. Маленький 14: 1802266. https://doi.org/10.1002/smll.201802266

    CAS Статья Google Scholar

  • Контроль связывания дофамина с помощью нового аптамера для биосенсора на основе FRET

    Основные моменты

    Требования к структуре и последовательности для нового аптамера дофамина, охарактеризованного ITC.

    Измерены буфер и зависящее от температуры связывание дофамина.

    Разработан складной датчик FRET, и эта информация полезна для разработки других типов биосенсоров, использующих этот аптамер.

    Abstract

    Дофамин — один из важнейших нейромедиаторов. В 2018 году было сообщено о высококачественном ДНК-аптамере дофамина. Однако фундаментального понимания его связывания и фолдинга не хватает, что имеет решающее значение для конструкции соответствующего биосенсора.Здесь мы провели тщательные анализы, используя метод без меток, называемый изотермической титрационной калориметрией (ITC), для изучения его вторичной структуры. Мы разделили этот аптамер на четыре области и индивидуально исследовали каждую из них. Мы подтвердили наличие двух стержней, но считается, что третий стержень является частью петли. Затем аптамер был усечен. Исходный аптамер имел K d 2,2 ± 0,3 мкМ при 25 ° C. Укорочение структуры на одну или две пары оснований увеличило K d до 6.9 и 44,4 мкМ соответственно. Связывание дофамина стимулировалось как увеличением концентрации Mg 2+ , так и снижением температуры. При 5 ° C достигается K d 0,4 ​​мкМ. Основываясь на этом понимании, мы разработали два биосенсора тушения с резонансным переносом энергии флуоресценции (FRET), которые отличаются только парой оснований. Более короткий сенсор имел в 3 раза большую чувствительность и предел обнаружения 0,9 мкМ. В 1% фетальной бычьей сыворотке датчик сохранил аналогичный предел обнаружения 1.14 мкМ. Также был продемонстрирован ратиометрический датчик FRET с двумя флуорофорами с низким пределом обнаружения 0,12 мкМ.

    Leave a Reply

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2019 © Все права защищены.